La vida n Universo (Stephen Hawking)


N esta tscharra, prestaría-mi specular un pouco cul disinvolvimiento de la vida nel Universo, & in particular, cul disinvolvimiento de vida intelligënte. Lhevarei-la a incluyi’ la raça humana, magar tener sido abondo fato mũîtscho l sou comportamiento pela historia, & non calculaho cul aciu d’adiudar a la sobrevivencia la specie. Duês questiones que discutirei son, “Quala ye la probabilidá de vida exsistiendo ayures pel Universo?, &, “Cumo será la vida a disinvolvese n futuro?”

Ye una question d’experiencia commun que les couses cinquen mas disordenades & chaótiques cul tiempu. Esta observaçon ye a ser elevada al status de lhey, la tyamada Segunda Lhey de la Thermodynámica. Diz que l montante total de disorden, ou entropía, n universo, siempre xorreç cul tiempu. Sí que ansí, la lhey mal se refier al montante total de disorden. Ye possible incrementa’l orden n un cuerpu, si l montante de disorden nes suês fhasteires circumdantes creç n un montante mayor. Esto ye lo que passa n un ente vivo. La vida ye a definise cumo un systema ordenau que ye a sofhitase por si contra la tendencia al disorden, & ye a arreproduzise. Ye dizir, ye a fhaer similares, ma independientes, systemas ordenaus. Cul fin de fhaer estes couses, el systema ha convertir fhuerça n daqué fhorma ordenada, cumo cibeira, lhuz solar ou curriente n fhuerça disordenada so la fhorma de calor. D’esta maneira, el systema ye a satisfaze’l requisitu de que l montante total de disorden xorreça, ente tanto, al in par, xorreciendo l orden in si & na suâ descendencia. Da vezo un ente vivo tien dous elementos: un compendio d’instrucçones diziendo-y al systema cumo se sofhitar & s’arreproduzir, & un mechanismu passando les instrucçones. Na sciencia natural, esses duês partes tyamen-se gënes & metabolismu pero val la pena emphatizar que nun fhai falta haber nada orgánico n elhos. Por casu, un virus de computador ye un programma que fhairá copies de si na memoria d’un computador, & que se transferirá a outros computadores. Ansí dirá elho lhibrar in dientro de la definiçon de systema vivu, que diera you. Tal que un virus orgánicu, ye una fhorma abondo degradada, por mal contener instrucçones ou gënes a penes, & nun tener metabolismu dalu de sou. In cuentes d’esso, arreprogramma l metabolismu l computador que lu hospeda, ou cellula. Ha hi xhente que qüestionára si los virus habríen contar cumo vida, por ser parásitos, & nun poder exsistir independientes de los sous amphitryones. Pero intos les mas de les fhormes de vida, la nuessa tamien, son parásites, por cibase & depender por sobrevivir d’outres fhormes de vida. Pienso haber de conta’ los virus de computador cumo vida. Igual diz elho daqué sobre la naturaleza humana, que la sola fhorma de vida creada por nós ta agora ye puramente destructiva. Fhala de crear vida a exemplo de nuesso. Tornarei mas tarde a les fhormes electróniques de vida.

Paeç-nos ser “vida” aquelho que normalmente se basa n cadenes d’átomos de carbono, cun daqué outros átomos, cumo azoe ou phósphoro. Podría-se specular poder haber vida cun daqué outra base chímica, cumo silicio, pero carbono paeç el casu mas favorable, por tene’ la chímica mas rica. El que los átomos de carbono tengan d’exsistir da fheitscho, cun les propriedaes que tienen, requier concasar fino constantes phýsiques, tales que la scala QCD, la carga eléctrica, & ta mesmamente la dimension de spacio-tiempu. Si esses constantes tuvieren valores significantemente differentes, bien el nucleu l átomu carbono nun diba ser stable, ou bien los electrones diben collapsar in nucleu. A la primer weyada, avulta tyama’l attençon que l Universo afine tan bien. Talvez esto ye evidencia de sta’l Universo specialmente concebido a fin de produzi’ la raça humana. Sí que ansí, ha-se d’andar attento a talos argumentos, por causa de lo que se conhoç cumo l Principio Anthrópico. Funda-se na affirmaçon autoevidente, que si l Universo nun s’adequare a la vida, nun mos andábemus intrugando por que concasa tan bien. Ye possible applica’l Principio Anthrópico, nes suês versiones fhuerte ou flrouxa. Nel Principio Anthrópico Fhuerte, suppon-se haber mũîtschos universos differentes, cada un cun differentes valores de les constantes phýsiques. In pequenhes cifres, los valores permittiran la exsistencia de couses cumo átomos de carbono, que son a actuar cumo bloques iguando systemas vivos. Al haber nós de vivir n un d’essos universos, nun mos debría surprehender que concasen fino les constantes phýsiques. De nun fhaelo, nun staríemus eiquí. La fhorma fhuerte l Principio Anthrópico nun ye per-satisfactoria. Qual significau operacional se y ye a dar a la exsistencia de todos essos outros universos? & si se xebren del Universo de nuesso, cumo ye a affectar al nuesso lo que passa n elhos? Alternativamente, adoptarei lo que se conhoç cumo Principio Anthrópico Flrouxo. Esto ye, considerarei los valores de les constantes phýsiques, cumo stando dades. Pero vou ver quales conclusiones se son a sacar del fheitschu de la exsistencia la vida n esti planeta, n esta etapa na historia l Universo.

Nun había carbono al intama’l Universo cul Bing Bang, cammin d’ha 15 bilhones d’anhos. Staría tan caldiaho, que toda materia habría remanecer in fhorma partícules, tyamades protones & neutrones. Inicialmente andaríen a pres los protones & neutrones in quantidá. Non obstante, n expandiendo-se l universo, sfrecería. Cammin d’un minutu lhouew del Bing Bang, la temperatura baltiaría so un bilhon de graus, approximadamente cien vezes la temperatura l Sol. A esta temperatura, los neutrones intamaríen sfhaese n mas protones. Si tolo que passare fhuere esto, toda materia nel Universo acabaría cumo elemento mas cincielho, hydrógëno, cun un nucleu consistente n un proton solu. Per outra parte, daqué de los neutrones cutiríen protones, & fundiríen-se formando l próximu elemento mas cincielho, helio, cun un nucleu iguau por dous protones & dous neutrones. Pero nun se formaríen elementos cun mas pesu, cumo carbono ou oxýgëno. Ye difficil figurase ser possible iguase un systema vivu, mal a penes cun hydrógëno & oxýgëno, quando tol Universo primordial andaba n toda vía calliente de mas cumo pa combinase átomos n molécules.

stefen h

L Universo continuaría expandiendo-se & arrefreciendo. Pero delhes zones tenríen densidaes un pouco mas altes que outres. L attracçon gravitacional de materia extra n estes zones diría ralentiza’ la expansion, & eventualmente parala. Ente tanto, collapsaríen formando galaxies & strelhes, de magar cerca dous bilhones d’anhos spueis del Big Bang. Delhes de les primeires strelhes seríen mas massives que l Sol nuessu. Seríen mas callientes que l Sol, & queimaríen del hydrógëno & del helio primitivos, resultando elementos cun mas pesu, talos que carbono, oxýgëno & fhierro. A esto mal y vagaríen unos quantos cientos de milhones d’anhos. Spueis, unes quantes strelhes spanyiríen cumo supernoves, & spardiríen los elementos de pesu tornando al Spacio, formando la materia prima de les tandes posteriores de strelhes.

Outres strelhes disten mũîtscho cumo pa les poder ver nós directamemente, si tuvieren planetas arrodiando-les. Pero ciertes strelhes, tyamades pulsares, emitten pulsos regulares d’ondes de radio. Observa-se una pouca variaçon na proporçon dalgunos pulsares, & interpreta-se cumo indicando perturbaçones, por tener planetas circumdantes del vultu la tierra. Los planetas circumdando pulsares nun son susceptibles de tener vida por morrer tolos seres vivos na explosion supernova que fhixzo a la strelha torna-se pulsar. Cun todo, el fheitschu d’observase tener unos quantos pulsares planetas indica ser possible na nuessa galaxia tener tamien planetas una fracçon razonable d’ente cien bilhones de strelhes. Les condiçones planetaries necessaries de la nuessa fhorma de vida podríen exsistir de magar cerca quattro bilhones d’anhos lhouew del Bing Bang.

El nuessu systema solar formou-se ha cammin de quattro bilhones & mediu d’anhos, ou cerca diez bilhones d’anhos de pueis del Big Bang, a partir de gas cun contaminaçon de restos de strelhes anteriores. La tierra fhoi formada por elementos cun mas pesu, incluyendo carbono & oxýgëno. Dalguna maneira, daqué d’essos átomos tyigaríen a organizase n fhorma molécules de ADN. Esto tien la famosa fhorma de doblre heliç, discobierta por Crick & Watson, n una cabanha na sé del New Museum in Cambridge. Connectando les duês cadenes na heliç, ha hi pares d’ácidos nucleícos. Ha hi quattro typos d’ácidos nucleícos, adenina, cytosina, guanina & thiamina. Dá-mi la lherça de nun se’l mîou sythetizador de fhala bon abondo pronunciando los sous nomes. Obviamente, nun fhoi proyectau cul fin de ser usau por biólogos moleculares. Una adenina n una cadena combina siempre cun una thiamina na outra cadena, & una guanina cun una cytosina. Ansí la sequencia d’ácidos nucleícos n una cadena define una única sequencia complementar, na outra cadena. Les duês cadenes son a xebrase intos & actuar cumo planilhes, iguando outres cadenes. Ansí les molécules de ADN son a reproduzi’ la informaçon gënética, codificada nes suês sequencies d’ácidos nucleícos. Secçones de la sequencia son tamien a usase fhaziendo proteínes & outros productos chímicos, que son a executa’ les instrucçones, codificades na sequencia, & fhaer concasa’ la materia prima cul aciu de reproduzise.

Nun se sabe cumo les molécules d’ADN appaecierun pela primer vez. Les possibilidaes de crease una molécula de ADN por fluctuaçones aleatories son per-pequenhes. Ha hi xhente que insinúa por tanto veni’ la vida a la Tierra d’ayures, & que ha hi semientes de vida fluctuando pela galaxia. Ente tanto, nun paeç probable poder sobrevivi’l ADN per mũîtschu tiempu na radiaçon spacial. & magar que podiere, nun diba adiudar mũîtscho a explica’ la incepçon de la vida, por se’l tiempu disponible de magar la formaçon del carbono mal pouco mas del doblre del tiempu que tien la Tierra.

Una hypóthesis ye que la formaçon dalgo cumo l ADN, que se ye a reproduzir, ye extremamente improbable. Sí que ansí, n un Universo cun una cifra per-grande, ou infinita, de strelhes, podría sperase occurrir n unos poucos systemas stellares, pero estos andaríen cun bien de dexebra ente si. El fheitschu d’occurrir vida na Tierra, nun ye surprehendente nin improbable. Mal ye una applicaçon del Principio Anthrópico Flrouxo: Si la vida appaeciere per outra parte n outru planeta, andábemus intrugando la causa d’appaecer a ende.

Si l appariçon de la vida n un determinau planeta fhuere per-improbable, podría-se sperar teney vagaho mũîtscho. Mas precisamente, podría-se sperar appaece’ la vida xhusto a tiempo de la subsequente evoluçon a seres sapientes, cumo nós, occurriendo primeiro de la exstincçon, definida pol tiempu vida l Sol. Vagará-y a esso pelos diez bilhones d’anhos, lhouew d’elhos el Sol inflará & ingulhirá la Tierra. Una fhorma sapiente de vida, sería quien a domina’ les travessíes spaciales, & ser quien a scapar a outra strelha. Pero d’outra maneira, la vida na Tierra diba star condemnada.

Exsiste evidencia fossil d’haber daqué vida na Tierra, cammin de trés milhones d’anhos & mediu ha. Elho igual fhoi mal a penes 500 milhones d’anhos lhouew de tornase la Tierra stable & fría abondo a fin de pode’ la vida disinvolvese. Pero a la vida podría-y tener vagaho siepte bilhones d’anhos el sou disinvolvimiento, & inda tener tiempu de mas evoluyendo a seres cumo nós, que se podríen intrugar del intamu la vida. Si la probabilidá de disinvolvese la vida n un planeta determinau ye per-pequenha, qual fhoi l motivu d’acontecer na Tierra, in cerca d’un 14avu del tiempu disponible?

El Surdir ceho de la vida na Tierra indica que ha hi una bona probabilidá del Surdir spontaneu de vida, in condiçones adequades. Quiçá hôubo daqué fhorma mas simple d’organizaçon, que iguare ADN. N appeciendo l ADN sería tan exitoso, que podría tener remplaçades da fheitscho les fhormes anteriores. Nun se sabe cumo seríen esses fhormes anteriores. Una possibilidá ye l ARN: Ye cumo l ADN; pero mas simple, & sin structura de doblre heliç. Extensiones curties de ARN son a reproduzise cumo ADN, & podríen eventualmente iguase cumo ADN. Nun ye possible fhaer ácidos nucleícos in laboratorio, a partir de material inerte, ente mas ARN. Pero dados 500 milhones d’anhos, & oceanos cobriendo lo mas de la Tierra, igual ha hi una probabilidá razonable d’ARN iguando-se casualmente.

Cumo ADN que se auto-reproduz, habríen errores aleatorios. Mũîtschos d’essos errores seríen danyibles, & morreríen. Outros seríen neutros. Ye dizir, nun affectaríen la funcçon del gën. Talos errores collaboraríen a una gradual deriva gënética, que paeç occurir in toles populaçones. & unos poucos errores seríen favorables al Sobrevivir de la specie. Sbilharíen-se elhos por selecçon natural Darwiniana.

El processu de la evoluçon orgánica intamou per-sele. Vagou-y dous milhones d’anhos & mediu disindulcase a partir de les primeires céllules, & outru bilhon d’anhos passar de peixes & reptiles a mammíferos. Pero intos la evoluçon paecîu apurase. Mal y vagou quajsi un milhon d’anhos disinvolvese a partir de los primeiros mammíferos ta nós. La razon ye que los peixes contienen la mayor parte de los wérganos humanos, & los mammíferos, tienen-los essencialmente todos. Tolo que se requirîu evoluyendo a partir de los primeiros mammíferos, cumo lemures, a humanos, fhoi concasar fino un pouco.

Pero na raça humana, la evoluçon cutîu una etapa crítica, comparable n importancia al disinvolvimiento d’ADN. Esto fhoi l disinvolvimiento de la fhala, & in particular fhala scripta. Elho significa poder passase la informaçon de gëneraçon in gëneraçon, pa tras de gëneticamente, pel ADN. Nun hôubo cambio detectable n ADN humano, que se provocare por evoluçon orgánica, nos diez mil anhos d’historia grabada. Pero la quantidá de Saber passau de gëneraçon a gëneraçon spoxigou enormemente. L ADN n seres humanos contien cammin de trés bilhones d’ácidos nucleícos. Non obstante, bien de la informaçon codificada n esta sequencia ye redundante, ou inactiva. & ya que l montante total d’informaçon util nos nuessos gënes, ye probable ser daqué similar a cien milhones de binarios. Un binario (bit) d’informaçon ye la respuesta a la intruga de sí / no. Por contrastar, una cobierta de papel d’una novella ye a contener dous milhones de binarios d’informaçon. Por tanto, l equivalente humanu de 50 novelles de la editorial Mills & Boon. Una bibliotheca nacional importante ye a contener cammin de los cinco milhones de lhibros, ou mas ou menos diez trilhones de binarios. Intos el montante d’informaçon transmittida n lhibros, ye cien mil vezes mas pa cul ADN.

Ente mas importante ye l fheitschu de poder ser camudada & actualizada la informaçon in lhibros intainando mũîtscho mas. Vagou-nos delhos milhones d’anhos evoluyir a partir de simios. Ente tanto n essi tiempu la informaçon util nel nuessu ADN mal camudaría probablemente unos poucos milhones de binarios. Intos la tasa de cambio orgánico n humanos, ye cammin del binario per anhu. Por comparança, ha hi quajsi que 50.000 lhibros nuevos publicaus n angles cada anhu, continiendo del orden de cien bilhones de binarios d’informaçon. Da cierto, la gran mayoría d’esta informaçon ye broça, & inutil pa qualquiera fhorma de vida. Pero, mesmamente ansí, la proporçon d’informaçon util podiendo ser addicionada ye milhones, igual bilhones, mayor que pa cun ADN.

Elho quier dizir que s’introu n una phase nueva d’evoluçon. Al intamu, la evoluçon procedía de selecçon natural, de mutaçones aleatories. Esta phase darwiniana durou pelos trés bilhones & mediu d’anhos, resultando n nós outros, entes que disinvolvierun la fhala, cun fin d’intercambiar informaçon. Pero nos postreiros diez mil anhos ou per hi, staríemus no que se y podría tyamar una phase de transmission externa. Ende, la grabaçon interna d’informaçon, transmittida per gëneraçones succesives n ADN, nun camudou significantemente. Pero la grabaçon externa, in lhibros, & n outres fhormes d’almazenase de lharga duraçon, spoxigou enormemente. Ha hi los que usarán el terminu, evoluçon, mal a penes cul material gënético transmittido internamente, & rebattiran l applicalo a informaçon transmittida externamente. Avulta-mi una vision per-strẽitscha. Somus mas que los nuessos gënes solo. Ser nun seremus mas fhuertes, ou inherentemente mas sapientes que los nuessos ancestros coveyos pero lo que nos strema de si, ye l Saber que accumulemus nos postreiros diez mil anhos, & particularmente, nos postreiros trés cientos. Avulta-mi lícito captar una vision mas amplia, & incorporar informaçon transmittida externamente, tamien cul ADN, na evoluçon de la raça humana.

La scala temporal de la evoluçon, na dómina de la transmission externa, ye la scala temporal de l accumulaçon d’informaçon. Indenantea yeren cientos, ou mesmamente miles d’anhos, pero agora esta scala temporal ingurrîu so los 50 anhos, ou menos. D’outra maneira, los cerebros cun que processamus esta informaçon evoluyerun solo na scala temporal darwiniana, de cientos de miles d’anhos. Esto intama causar problemas. Nel sieglo XVIII, dizía-se haber un home que lhera tolos lhibros scriptos. Pero inguanho, si se lhe un lhibru cada díe, lhevaría cammin de 15.000 anhos lhe’ los lhibros d’una bibliotheca nacional. Ente tanto, mũîtschos mas lhibros se scribiríen.

Elho quier dizir que dala persona ye a dominar ma un pequenhu requeixu del Saber humanu, la xhente tien que se specializar, in campos cada vez mas strẽitschos. Elho será probablemente una gran limitaçon futura. Da cierto nun podemus continuar, per mũîtschu tiempu, cun la tasa exponencial de xorrecer del Saber que tuviemus nos últimos trés cientos anhos. & cun todo, limitará mas fhuerte & minaçante les futures gëneraçones tener in toda vía instinctos, & in particular, los impulsos aggresivos que tuviemus na dómina de les cueves. L aggresion, na fhorma d’oppresion ou de matar outros homes, & quitayos les suês muyeres & cibeira, fhoi de nidia superioridá na sobrevivencia, ta l tiempu presente pero agora igual sfhai la raça humana inteira & bien del restu la vida na Tierra. Una gerra nuclear ye indagora la minaça mas immediata pero ha hi outres, tales que la suelta d’un virus gëneticamente manipulau ou l effeitu hibernadeiru tornando-se instable.

Nun ha hi tiempu, sperando nós por una evoluçon darwiniana que nos fhaiga mas sabios, & cun meyor predisposiçon. Si que ansí andamus intrando n una phase nueva, que podría tyamase evoluçon autodissenyada, u vamus ser quien a camudar & ameyora’l nuessu ADN. Ha hi un proyectu agora n martscha chartographiando la inteira sequencia l ADN humano. Costará unos quantos bilhones de dóllares pero ye peccata minuta n un proyectu d’esta importancia. Una vez lheíu por nós el lhibru la vida, intamaremus scribiendo correcçones. Al intamu, essos cambios confinarán-se a reparar defectos gënéticos, cumo fibrosis cýstica, & dystrophia muscular. Estes son controllades por gënes únicos, & por ende son enforma facil d’identificar & repasar. Outres qualidaes, cumo sapiencia, controllen-se probablemente por una gran quantidá de gënes. Será mũîtscho mas difficil atopalos, & manipula’ les relaçones ente si. Sí que ansí, stou ciertu que nel próximu sieglo, la xente discobrirá cumo modificar intrambos sapiencia & instinctos cumo l aggresion.

Approbarán-se lheyes contra la manipulaçon gënética cun humanos pero habrá xhente que nun será quien a resjsti’ la temptaçon de fhaer progressar characterístiques humanes, tales que l tamanyu la memoria, resjstencia a la infirmidá & duraçon de la vida. Quando appaecieren los superhumanos, habran grandes problemas políticos cun los humanos retrasaus, que nun seran quien a competir. Presumiblemente, exstingiran-se, ou tornarán-se irrelevantes. In cuentes d’elho, habrá una raça de seres autodissenyaus, que progressarán cun una tasa d’evoluçon a infinito.

Si esta raça ye quien a arredissenyase, reduziendo ou eliminando la minaça de l autodestrucçon, expandirá-se probablemente, & colonizará outros planetas & strelhes. Cun todo, travessíes spaciales a grandes distancies serán diffíciles pa les fhormes de vida que se basen na chímica, tal que ADN. La extension temporal natural vital d’essos ntees ye curtia, in comparança cul tiempu de travessía. A communya cun la theoría de la relatividá, nada ye a deplaçase mas aina que la lhuz. Ansí que la travessía cun retornu a la strelha mas próxima diba vagar minimamente oîtscho anhos, & ta l centro la galaxia, cammin de los cien mil anhos. Na scienciaficçon, suppera-se esta difficultá cun vórtices spaciales, ou diendo per extradimensiones. Pero nun creo ser possible, tanto dá quan sapiente la vida se torne. Na theoría de la relatividá, si se ye a deplaçar mas aina que la lhuz, ye-se a retrodeplaçar in tiempu. Elho provocaría problemas cun xhente diendo retroceder, & camudando l passaho. Speraría-se tamien ver grandes cifres de tôuristas del futuro, curiosos por ve’ los nuessos pintorescos & antiquaus vezos.

Podría ser possible utiliza’ la manipulaçon gënética fhaziendo que la vida basada nel ADN sobreviva indefinidamente, quando menos per cien mil anhos. Pero una maneira mas facil, que anda dientro ya quajsi de les nuesses capacidaes, diba ser inviar máchines. Seríen iguades durando abondo nes travessíes interstellares. N aportando a una strelha nueva, podríen pousar n un planeta afheitschu, & minar material produciendo mas máchines, que podríen inviase a outres nueves strelhes. Estes máchines seríen una nueva fhorma de vida, basada n componentes mechánicos & electrónicos, mas que n macromolécules. Seríen a remplaçar eventualmente la vida basada n ADN, cumo l ADN igual remplaçou una fhorma anterior de vida.

Esta vida mechánica podría ser tamien syada. Intos paeç que la dómina de transmission externa d’evoluçon mal tenrá sido a pena un interludio per-curtio, ente la phase darwiniana & la orgánica ou mechánica, phase autodissenyada. Indica-se esto nel diagramma que vien, que nun ha tener scala, por nun haber maneira de poder insinyar un periodu de diez mil anhos na mesma scala que bilhones d’anhos. Quanto y vagará a esta phase autodissenyada abre-se a qüestiones. Igual ye instable, & la vida sfhai-se elha mesma, ou martscha scontra un cammin in sin salida. Si esso nun aportare, sería a sobrevivi’ la muerte l Sol in cinco bilhones d’anhos, mudando-se a planetas al rodiu d’outres strelhes. La mayoría les strelhes tenrán-se exstingido n outros 15 bilhones d’anhos mas ou menos, & l Universo approximaría-se a un stadio de completu disorden, a communya cun la Segunda Lhey de la Thermodynámica. Pero Freeman Dyson demonstrou que, magar esto, la vida ye a adaptase a la diminuçon continua d’approvisionamiento d’energía & intos in principio ye a continuar siempre.

Quales diben se’ les possibilidaes d’atopanos cun daqué fhorma de vida extraterrestre n explorando la galaxia? Si l argumento de la scala temporal del Surdir de la vida na Tierra ye correcto, ergo podríen, in principio, haber mũîtsches outres strelhes, cun los sous planetas teniendo vida n elhos. Daqué d’essos systemas stellares formaríen-se cinco bilhones d’anhos primeiro que la Tierra. Intos, por que la galaxia nun anda fherviendo cun fhormes de vida autodissenyada mechániques ou orgániques? Por que la Tierra nun tien nunca sido vjsitada, & nunca colonizada? Nun cuento cun propuestes que contienen los OVNI cumo entes del spacio exterior. Pienso que qualquiera vjsita por extraterrestres diba ser mũîtscho mas obvia, & probablemente tamien, mũîtscho mas disagradable.

Quala ye la explicaçon de por que nun se nos vjsitou? Una hypóthesis ye se’l argumento sobre l Surdir de la vida na Tierra incorrecto. Igual la probabilidá d’appaecer vida spontaneamente ye tan baxa, que la Tierra ye l únicu planeta na galaxia, ou nel Universo observable, u appaecîu. Outra hypóthesis ye haber una probabilidá razonable de fhormase systemas auto-reproduzibles, cumo céllules, pero les mas d’esses fhormes de vida nun acabar n sapiencia. Aveza-se pensar in vida sapiente cumo inevitable consequencia de la evoluçon pero l Principio Anthrópico debría-nos avisar de sfhoutanos d’argumentos talos. Ye mas probable se’ la evoluçon un processu aleatoriu, cun sapiencia cumo unu d’una gran quantidá de possibles resultaus. Nun ye nidio tene’ la sapiencia dalgun valor de sobrevivencia a lhargu terminu. Bacteries, & outros organismos unicellulares, continuaríen viviendo, si tola outra vida na Tierra fhuere annichilada poles nuesses acçones. Ha hi sofhitu pa la oppinion de que la intelligëncia fhoi un disindolcu improbable de la vida na Tierra, a partir del cómputu de la evoluçon. Vago-y mũîtscho, dous bilhones & mediu d’anhos, dir de seres unicellulares a pluricellulares, que son un necessariu precursor de la intelligëncia. Ye una bona fracçon del tiempu total disponible, inante spanyi’l Sol. Intos sería consistente cun la hypóthesis que la probabilidá disinvolve’ la vida sapiencia ye baxa. N esti casu, speraríemus atopar mũîtsches outres fhormes de vida na galaxia, pero ye remoto atopanos cun vida sapiente. Outra maneira, na que la vida nun sería a disinvolver vida ta una etapa intelligënte, diba ser si un asteroide ou cometa cutiere l planeta. Stamus acabantes d’observa’ la collision d’un cometa, Schumacher-Levi, cun Xhúpiter. Iguou una riestra d’enormes boles de fhuew. Piensa-se se’ la responsable de la exstincçon de los dinosaurios la collision d’un cuerpu celeste bien pequenhu cun la Tierra ha cerca 70 milhones d’anhos. Unos poucos mammíferos primitivos sobrevivierun pero todo tan grande cumo un humano, sería da cierto annichilaho. Ye difficil predizi’ la freqüencia de la occurencia d’estes collisiones, pero una speculaçon razonable diba ser cada 20 milhones d’anhos de media. Si esta cifra fhuere correcta, diba querer dizir tenese disinvuelto la vida na Tierra solo pola suerte de nun haber habido collisiones series nos últimos 70 milhones d’anhos. Outros planetas na galaxia, nos que se disinvolviere la vida, podríen nun tener un periodu lhargu abondo lhibre de collisiones cumo pa la evoluçon a seres intelligëntes.

La tercer possibilidá ye haber una probabilidá razonable de formaçon de vida, & d’evoluçon in seres intelligëntes, na phase d’evoluçon externa. Pero n esti punctu, el systema torna-se instable, & la vida sapiente destruye-se a si mesma. Sería una per-pessimista conclusión. Anhelo mũîtscho que nun seya verdadeira. Prefiero una quarta possibilidá: habría outres fhormes de vida intelligënte per ende a fhuera pero que nos passaríen per alto. Había un proyectu tyamau SETI, in geta de vida sapiente extraterrestre. Involucraba explorar radiofreqüencies cul aciu de ver si podíemus apanyar sinyales de civilizaçones extraterrestres. Avultou-mi valir esti proyectu la pena sofhitalu, magar ser cancellau por falta fhundos. Pero hemus ser mas roceanos a la hora de responder, ta evoluyir un pouco mas. Atopanos cun una civilizaçon mas adelantrada, na etapa presente, podría ser un pouco cumo los habitantes primitivos d’Ámerica atopando-se cun Colon. Nun creo ser elhos meyores.

Esso ye tolo que tengo que dizir. Agradecíu por ascuîtschame.


Reta’l pensamiento reconhocido ye fundamental al resolver problemas


Niels Bohr, l adversariu menos conhocíu d’Einstein, mereç abonda mas attençon.

Un de los dous scientíficos de referencia participantes n una riestra debates ente les gërres a cerca de la philosophía de la sciencia ye icónicu. Albert Einstein ye famosu n tol mundo, mesmamente pa la xhente que nunca comprehendiera les theoríes de sou. El sou compintsche de disputes intellectuales de los 1920’s & 30’s, contrariamente, ye inxhustamente pouco conhocíu.

Magar ganha’l premio Nobel de phýsica & ser mas que un adversariu d’Einstein, Niels Bohr anda lhueñe de tene’l renome merecíu poles suês conquistes. Trespassando la sciencia, les suês idees sobre educaçon, specialmente infhoutando-se na mocedá cul fin d’imburria’ les lhendes del Saber, inspiren a professores & studiantes.

Nacíu n Dinamarca n 1885, Bohr yera talentosu ya de pequenhin. Tamien xhugára n un equipu la lhiga danesa & pa tras tocara la fabricaçon de vidro al nun attende’ les suês necessidaes los tubos de test d’un laboratorio universitario.

En 1911, andaba n Anglaterra n una communidá scientífica, devorando nueves pesquises al rodiu del átomu. Dous anhos mas tarde, mangou-se al frente de la phýsica quántica, creando l modello atómico que se tornaría la base de la nuessa comprehension de cumo se construyîu l Mundo. Ganhou l premio Nobel in 1922 & intamou la griesca pública cun Einstein sobre un assumptu que probablemente deixaría al commun de los mortales ximielgando la cabeça: la non localidá quántica.

Los sous alderiques son vistos cumo una de les marques d’awa de la investigaçon scientífica de la primeira media parte l sieglo XX. Un cambio d’eleiçon fhixzo a Einstein discharta’ la theoría de tener que s’intende’ la mechánica cumo probabilidá n sin explicaçon causal, diziendo tener elhi la certeza que Dîous nun anduviera xhugando a los dados. Bohr respondîu : “Para ya de dizir a Dîous lo que ha fhaer”.

En 1921 abrîu l Instituto Niels Bohr, una vez passaus quattro anhos ganhando l sofhitu l gubiernu danes & apañando financiamiento d’impreses & de donantes privaus que lu deixaríen iguar un centru d’excelencia pa una nueva fhurnada de phýsicos.

El sou instituto na Universidá de Copenhagen tornou-se quajsi que una lhinya de producçon de phýsicos de Premio Nobel. Quattro de los sous miembros recibierun la honra suprema, ente elhos unu de los seys fhiyos de Bohr.

El trabayu l instituto amoldou l Mundo. Tenemus a Bohr & a los sous discípulos que yos agradece’ l importante progressu de la mechánica quántica. Si esto sona cumo a zafarrantscho scientífico, tentai de pensar na vida n sin electrónica nel muxicu de los computadores, de los teléphonos móbiles, dispositivos de CD, de los lasers & scanners médicos. Essos dispositivos, & mũîtschos outros mas, gasten de la téchnica que spoxigou de magar les pesquises de Bohr. L instituto menta un studio affirmando que l 30% del PIB del mundo occidental ye a ser traçau ta l pensamiento de Bohr.

La razon subiacente de les conquistes del instituto de Bohr ye daqué que les schueles de negocios & los studiantes fharíen bien n anotar. Nun fhoi denheiro la garantía del éxitu. Lo que fhixzo la differencia fhoi l infhoutu por qüestiona’l pensamiento reconhocido pola mocidá que vien impobinando l camin. Bohr demonstrou infhoutu n nuevos scientíficos que outres figures ya bien stablicides veríen abondo verdes cumo pa s’infhoutar da fheitscho.

Una approximaçon u les innovaçones & l enthusiasmu de la mocidá todo beneficien podía ser un paradigma de gran parte de la educaçon de ka xhente n Poder. Si la xhente moço tuviere l’infhoutu de fhaer couses de maneira differente, dibemu ser  quien a approximanos a la soluçon de problemas cumo polluçon, consumu carburantes, seques & falta cibeira. La schuela negocios ye un sitiu ideal u semar una philosophía del typu.

D’ascendencia hebrea & trabayando na Dinamarca occupada polos nazis, un scientíficu notable cumo Bohr nun podía scapar a les attençones del Reich. Evitando que los nazis confiscaren duês medalhes Nobel d’ouro dades a collegas xhudíos, Bohr & un chímicu danes decidierun, arriscando-se enforma, dissolveles, scondiendo-les n un vasu de líquido color ocre inante  tyiga’ les tropes & arrebuscar pel sitiu (Bohr sacára a puya la suâ propria medalha pal sofhitu de la gërra finesa indenantea la invasion). N un épilogu notable, n acabando la gërra, el chímicu invertîu l processu & inviou l ouro a la Fundaçon Nobel, que arrefhairía les medalhes presentando-les a los vencedores del premio.

Bohr continuou adiudando a los scapaus de los nazis & intos, n emittiendo-se l mandato de prender xhudíos in Copenhagen na seronda de 1943, scapou a la Gran Bretanya cul fin d’adiudar a los Aliaus a assumi’ la delantreira na carreira atómica.

El sou instituto indagora prospera & tien una plraca declarando se’l edificio u la phýsica atómica & la phýsica moderna nacieran n un ambiente creativu special inspirau por Niels Bohr. Non obstante ser bien cierta essa sobria affirmaçon, nun y fhai xhusticia adequada a una figura subestimada.


Haplogruppo I-M253

L haplogruppo I-M253, conhoç-se-lu tamien cumo I1, ye un haplogruppo l chromosoma Y. Los marcadores gënéticos confirmantes cumo identificantes de I-M253 son los SNPs M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L 125/S65, L157.1, L186, e L187. Ye l principal ramal l haplogruppo I-M170 (I*).

L haplogruppo cute l sou picu freqüencial in Suecia (52% de los homes in Condau de Västra Götaland) & de Finlandia occidental (trespassa l 50% na provincia de Satakunta). In términos de medies nacionales, I-M253 atopa-se n 35-38% de los homes suecos, 32,8% de los daneses, cammin de 31,5% de los norvegos & cerca de 28% de los fineses de sexu masculin.

L haplogruppo I-M253 ye l principal ramal l haplogruppo I* (I-M170), presente n Europa de magar tiempos antiguos. El principal ramal de I* ye l I-M438, tamien conhocíu cumo I2.

Lhouew d’arreclassifica-se 2008, al haplogruppo conhocía-se-lu cumo I1a, un nome que ya se y attribuyera a un ramal primariu, l haplogruppo I-DF29. Los outros ramales principales de I1 (M253) son I1b (S249/Z131) & I1c (Y18119/Z17925).



Segun un studio que se publicou n 2010, el I-M253 formou-se ha ente 3,170 & 5,000 anhos, nel periodu Chalcolíthicu n Europa. Un nuevu studio, in 2015, estimaba la procedencia de 3,470 a 5,070 anhos ha, ou ente ha 3,180 & 3,760 anhos, gastando duês téchniques differentes. Paeç spardese inicialmente del territorio que ye wey Dinamarca.

Un studio de 2014, n Hungría, revelou restos de nueve specímenes de la Cultura la Cerámica Bandes, un d’ente elhos lhevando l SNP M253 definitoriu l haplogruppo I1. Piensa-se star esta cultura presente d’ente 6.500 a 7.500 anhos ha.


I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L 125/S65, L157.1, L186, e L187) ou I1

  • I-DF29 (DF29/S438); I1a

    • I-CTS6364 (CTS6364/Z2336); I1a1

      • I-M227; I1a1a

      • I-L22 (L22/S142); I1a1b

        • I-P109; I1a1b1

        • I-L205 (L205.1/L939.1/S239.1); I1a1b2

        • I-Z74; I1a1b3

        • I-L300 (L300/S241); I1a1b4

          • I-L287

            • I-L258 (L258/S335)

          • I-L813

    • I-Z58 (S244/Z58); I1a2

      • I-Z59 (S246/Z59); I1a2a

        • I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1

          • I-Z140 (Z140, Z141)

            • I-L338

            • I-F2642 (F2642)

          • I-Z73

            • I-L1302

          • I-L573

          • I-L803

        • I-Z382; I1a2a2

      • I-Z138 (S296/Z138, Z139); I1a2b

        • I-Z2541

    • I-Z63 (S243/Z63); I1a3

      • I-BY151; I1a3a

        • I-L849.2; I1a3a1

        • I-BY351; I1a3a2

            • I-CTS10345

              • I-Y10994

            • I-Y7075

        • I-S2078

          • I-S2077

            • I-Y2245 (Y2245/PR683)

              • I-L1237

                • I-FGC9550

              • I-S10360

                • I-S15301

              • I-Y7234

        • I-BY62 (BY62); I1a3a3

  • I-Z131 (Z131/S249); I1b

    • I-CTS6397; I1b1

  • I-Z17943 (Y18119/Z17925, S2304/Z17937); I1c

Distribuçon territorial

I-M253 atopa-se na so mayor densidá al norte d’Europa & d’outros paises que suffrieran intensa migraçon d’Europa l norte, bien in Periodu de Migraçon, bien in periodu vikingu ou bien in tiempos modernos. Atopa-se n tolos sitios que invadierun los vieyos pueblos germánicos & vikingos.

Na dómina moderna, poblaçones significatives del I-M253 tamien prendieran raizes nes naçones d’immigrantes & excolonies europees, tales como los USA, Australia & el Canadá.


tamanyu patron I (total) I1 (I-M253) I1a1a (I-M227) fhonte
Austria 43 9.3 2.3 0.0 Underhill et al. 2007
Bielo-Russia: Vitebsk 100 15 1.0 0.0 Underhill et al. 2007
Bielo-Russia: Brest 97 20.6 1.0 0.0 Underhill et al. 2007
Bosnia 100 42 2.0 0.0 Rootsi et al. 2004
Bulgaria 808 26.6 4.3 0.0 Karachanak et al. 2013
República Checa 47 31.9 8.5 0.0 Underhill et al. 2007
República Checa 53 17.0 1.9 0.0 Rootsi et al. 2004
Dinamarca 122 39.3 32.8 0.0 Underhill et al. 2007
Anglaterra 104 19.2 15.4 0.0 Underhill et al. 2007
Estonia 210 18.6 14.8 0.5 Rootsi et al. 2004
Estonia 118 11.9 Lappalainen et al. 2008
Finlandia (nacional) 28.0 Lappalainen et al. 2006
Finlandia: Oeste 230 40 Lappalainen et al. 2008
Finlandia: Este 306 19 Lappalainen et al. 2008
Finlandia : Satakunta 50+ Lappalainen et al. 20089
Francia 58 17.2 8.6 1.7 Underhill et al. 2007
Francia 12 16.7 16.7 0.0 Cann et al. 2002
Francia (Baxa-Normandía) 42 21.4 11.9 0.0 Rootsi et al. 2004
Allemania 125 24 15.2 0.0 Underhill et al. 2007
Grecia 171 15.8 2.3 0.0 Underhill et al. 2007
Hungría 113 25.7 13.3 0.0 Rootsi et al. 2004
Irlandia 100 11 6.0 0.0 Underhill et al. 2007
Kazan Tártaros 53 13.2 11.3 0.0 Trofimova 2015
Letonia 113 3.5 Lappalainen et al. 2008
Lituania 164 4.9 Lappalainen et al. 2008
Paises Baxos 93 20.4 14 0.0 Underhill et al. 2007
Norvegia 2826 31.5 Eupedia 2017
Russia (nacional) 16 25 12.5 0.0 Cann et al. 2002
130 16.9 5.4 0.0 Underhill et al. 2007
Russia Kostroma 53 26.4 11.3 0.0 Underhill et al. 2007
Russia Smolensk 103 12.6 1.9 0.0 Underhill et al. 2007
Russia Voronez 96 19.8 3.1 0.0 Underhill et al. 2007
Russia Arkhangelsk 145 15.8 7.6 0.0 Underhill et al. 2007
Russia Cossacos 89 24.7 4.5 0.0 Underhill et al. 2007
Russia Carelios 140 10 8.6 0.0 Underhill et al. 2007
Russia Carelios 132 15.2 Lappalainen et al. 2008
39 5.1 2.6 0.0 Underhill et al. 2007
Slovaquia 70 14.3 4.3 0.0 Rootsi et al. 2004
Slovenia 95 26.3 7.4 0.0 Underhill et al. 2007
Suecia (nacional) 160 35.6 Lappalainen et al. 2008
Suecia (nacional) 38.0 Lappalainen et al. 2009
Suecia: Västra Götland 52 Lappalainen et al. 2009
Suiça 144 7.6 5.6 0.0 Rootsi et al. 2004
Turquía 523 5.4 1.1 0.0 Underhill et al. 2007
Ukrania Lvov 101 23.8 4.9 0.0 Underhill et al. 2007
Ukrania Ivanovo-Frankov 56 21.4 1.8 0.0 Underhill et al. 2007
Ukrania Hmelnitz 176 26.2 6.1 0.0 Underhill et al. 2007
Ukrania Tcherkássi 114 28.1 4.3 0.0 Underhill et al. 2007
Ukrania Belgorod 56 26.8 5.3 0.0

Underhill et al. 2007

Gran Bretanya

Mappa amosando la distribuçon de chromosomas Y n una secçon transversal d’Anglaterra & Pais de Gales, del trabayu “Chromosoma Y: evidencia de migraçon massiva d’anglo-saxones“. los auctores attribuyen les differencies in freqüencies del haplogruppo I a la migraçon anglo-saxona n massa pa Anglaterra, magar nun ser ansí n casu l Pays de Gales.

In 2002 asoleyou-se un artículu scriptu por Michael E. Weale & collegas presentando evidencia gënética de differencies ente les poblaçones anglesa & galesa, incluyendo un nivel porcentual perciptiblemente mas altu d’haplogruppo I-ADN n Anglaterra que n Pais de Gales. Vîu-se esto intos como una evidencia convincente d’invasion anglo-saxona massiva del oriente de Gran Bretanya a partir del norte d’Allemania & Dinamarca, contra l Periodu de Migraçon. Los auctores assumen fundase les poblaçones cun fhuertes proporçones d’haplogruppo I n Allemania l norte ou nel sur de Scandinavia, sobre maneira n Dinamarca, & migra’ los sos antepassaus pel Mar del Norte cabo les migraçones anglo-saxones & vikinges daneses. La principal revindicaçon de los investigadores fhoi

ser necessaria d’aquelha un eventu d’inmigraçon anglo-saxona affectando al 50-100% del fundu gënéticu de los homes d’Anglaterra central. Observamus, ente tanto, nun mos deixar differencia’ los nuessos datos un eventu cincielhamente addicionau al fundu hereditariu autochthone de los homes d’Anglaterra central, d’outru u los homes autochthones fhueran xebraus ayures ou onde los varones nativos fhueran reduzidos en númeru … Esti studio amuesa que la raya galesa fhoi mas una barreira gënética pal chromosoma Y & pal fluxu gënes anglo-saxon que l mesmu Mar del Norte … Estos resultaus indiquen ser una fronteira política mas importante que una geophýsica n una structuraçon gënética de la poblaçon.

Distribuçon los haplogruppos del chromosoma Y de Capelli et al. (2003). L haplogruppo I anda presente n toles populaçones, cun les freqüencies mas altes n oriente & baxes n occidente. Paeç nun haber una discontinuidá na lhende cumo apercibido por Weale et al. (2002)

In 2003, un artículu asoleyau por Christian Capelli & collegas sofhitou, magar que modificades, les conclusiones de Weale & collegas. Essi trabayu, que presentou specímenes de Gran Bretanya & d’Irlanda n quadrielha, atopou una minor differencia ente amuestres galeses & angleses, cun una diminuçon gradual na freqüencia del haplogruppo I diendo scontra occidente nel sur de Gran Bretanya. Los resultaus indiquen a los auctores tener influyido a sgaya los invasores vikingos norvegos na parte norte les Islles Britániques, magar tener toles amuestres angleses & scoceses de Gran Bretanya influencia allemana &/o danesa.

Miembros proeminentes del I-M253

Alexander Hamilton, por stirpe & prueba gënética de los sous descendientes (figurando-se cumo cierta la paternidá que y correspuende pola suâ stirpe), mangou-se-lu dientro l haplogruppo Y-ADN I-M253.

Birger Jarl, ‘Duque de Suecia” de la Casa los Godos de Bjalbo, fundador de Stocolmo, cun los sous restos inhumaus n una ecglresia atopaus in 2002, resultou ser I-M253.

Occupantes del Mayflower William Brewster, Edward Winslow & George Soule per pruebes de ADN


ADN: modello: cadena 1 diffier de la cadena 2 n un únicu par de base local (un C >> T del polymorphismu).

Les que vienen son les specificaçones téchniques de les mutaçones de los SNP & STR conhocidos del haplogruppo I-M253.

Nome: M253

Typu: SNP
Fhonte: M (Peter Underhill de la Universidá de Stanford)
Posiçon: ChrY:13532101..13532101 (+ cadena)
Posiçon: (pares de base): 283
Tamañu total (pares de base): 400
Extension: 1
Iniciador molecular F (speyo 5’→ 3′): GCAACAATGAGGGTTTTTTTG
Iniciador molecular R (complementar 5’→ 3′): CAGCTCCACCTCTATGCAGTTT
Alteraçon nucleotideos allelos (mutaçon): C por T

Nome: M307

Typu: SNP
Fhonte: M (Peter Underhill)
Posiçon: ChrY:21160339..21160339 (+ cadena)
Extension: 1
Alteraçon nucleotideos allelos (mutaçon): G por A

Nome: P30

Typu: SNP
Fhonte: PS (Michael Hammer , de la Universidá d’Arizona & James F. Wilson, de la Universidá d’Edinburgo)
Posiçon: ChrY:13006761..13006761 (+ cadena)
Extension: 1
Alteraçon nucleotideos allelos (mutaçon): G por A
Regio: ARSDP

Nome: P40

Typu: SNP
Fhonte: PS (Michael Hammer & James F. Wilson)
Posiçon: ChrY:12994402..12994402 (+ cadena)
Extension: 1
Iniciador molecular: GGAGAAAAGGTGAGAAACC
Iniciador molecular R: GGACAAGGGGCAGATT
Alteraçon nucleotideos allelos (mutaçon): C por T
Regio: ARSDP

Bancos de datos haplogruppo I