La vida n universo (Stephen Hawking)

Audio:

N esta tsarra, prestaría-mi specular un pouco cul disinvolvemiento de la vida nel universo, & n particular, cul disinvolvemiento de vida intelligënte. Lhevarei-la a inclui’ la raça humana, magar tener sido abondo fato mũîtho l sou comportamiento pela historia, & nun lo calcular por adiudar a la sobrevivencia la specie. Duês questiones que discutirei son, “Quala ye la probabilidá de vida exsistiendo ayures pel universo?” &, “Como será la vida a disinvolvese n futuro?”

Ye una question d’experiencia commun que les couses cinquen mas disordinades & chaótiques cul tiempu. Esta observaçon ye a elevase al status de lhey, la tyamada Segunda Lhey de la Thermodynámica. Diz que l montante total de disorde, ou entropía, n universo, siempre xorreç cul tiempu. Sí q’ansí, la lhey mal se refier al montante total de disorde. Ye possible incrementa’l orde n un cuœrpu, si l montante de disorde nes suês fhasteires circumdantes creç n un montante mayor. Esto ye lo que passa n un ente vivo. La vida ye a definise cumo un systema ordinau que se ye a sofhitar por si mesmu contra la tendencia al disorde & ye a arreproduzise. Ye dizir, ye a fhaer similares, solo q’independientes, systemas ordinahos. Por fhaer estes couses, el systema ha convertir energìa n daqué fhorma ordinada, cumo cibeira, lhuz solar ou curriente n energìa disordinada so la fhorma de calor. D’esta maneira, el systema ye a satisfaze la requisiçon de que l montante total de disorde xorreça, ente tanto, al in par, xorreciendo l orde n si mesmu & na suâ descendencia. Da vezo un ente vivo tien dous elementos: un compendio d’instrucçones diziendo-y al systema cumo se sofhitar & s’arreproduzir, & un mechanismu passando les instrucçones. Na sciencia natural, esses duês partes tyamen-se gënes & metabolismu solo que val la pena emphatizar que nun fhai falta haber nada orgánico n elhos. Por casu, un virus de computador ye un programma que fhairá copies de sigo na memoîra d’un computador, & que se transferirá a outros computadores. Ansí dirá elho lhibrar dientro la definiçon de systema vivu, que diera you. Cumo un virus orgánicu, ye una fhorma abondo degradada, por mal contener instrucçones ou gënes a penes, & nun tener metabolismu dalu de sou. In cuœntes d’esso, arreprogramma l metabolismu l computador que lu hospeda, ou cellula. Ha hi xhente que questionara si los virus habríen contar cumo vida, por ser parásitos, & nun poder exsistir independientes de los sous amphitryones. Intos les mas de les fhormes de vida, la nuœssa tamien, son parásites, por cibase & depender por sobrevivir d’outres fhormes de vida. Pienso haber de conta’ los virus de computador cumo vida. Egual diz elho daqué sobre la naturaleza humana, que la sola fhorma de vida creada por nós t’hagora sea puramente destructiva. Fhala de crear vida a exemplo de nuœsso. Tornarei mas tarde a les fhormes electróniques de vida.

Paeç-nos ser “vida” aquelho que normalmente se basa n cadenes d’átomos de carbono, cun daqué outros átomos, cumo azoe ou phósphoro. Podría-se specular poder haber vida cun outra base chímica, cumo silicio, solo que carbono paeç el casu mas favorable, por tene’ la chímica mas rica. El que los átomos de carbono tengan d’exsistir da fheitho, cun les propriedahes que tienen, requier concasar fino constantes phýsiques, cumo la scala QCD, la carga eléctrica, & ta mesmamente la dimension de spacio-tiempu. Si esses constantes tuvieren valores significantemente differentes, bien el nucleu l átomu carbono nun diba ser stable, ou bien los electrones diben collapsar nel nucleu. A la primer wœyada, avulta tyama’ l attençon que l universo afine tan bien. Talvez esto sería evidencia de sta’l universo specialmente concebido a produzi’ la raça humana. Sí q’ansí, tien que s’andar attento a talos argumentos, por causa de lo que se conhoç cumo l Principio Anthrópico. Funda-se na affirmaçon autoevidente, que si l universo nun s’adequare a la vida, nun mos andaríemus introgando por que ye que concasa tan bien. Ye possible applica’l Principio Anthrópico, nes suês versiones fhuœrte ou flrouxa. Nel Principio Anthrópico Fhuœrte, suppon-se haber mũîthos universos differentes, cada un cun differentes valores de les constantes phýsiques. In pequenhes cifres, los valores permittiran la exsistencia de couses cumo átomos de carbono, que son a actuar cumo bloques eguando systemas vivos. Al haber nós de vivir n un d’essos universos, nun mos tenría que surprehender que concasen fino les constantes phýsiques. De nun fhaelo, nun staríemus eiquí. La fhorma fhuœrte l Principio Anthrópico nun per-ye satisfactoria. Quala significaçon operacional se y ye a dar a la exsistencia de todos essos outros universos? & si se xebren del universo de nuœsso, como ye a affectar al nuœsso lo que passa n elhos? Alternativamente, adoptarei lo que se conhoç cumo Principio Anthrópico Flrouxo. Esto ye, considerarei los valores de les constantes phýsiques, cumo stando dades. Sí q’ansí vou ver quales conclusiones se son a sacar del fheithu de la exsistencia la vida n esti planeta, n esta etapa na historia l universo.

Nun había carbono al intama’l universo cul Bing Bang, cammin d’ha quinze bilhones d’anhos. Staría tan caldiaho, que toda materia habría remanecer in fhorma partícules, tyamades protones & neutrones. Inicialmente andaríen a pres los protones & neutrones in quantidá. Non obstante, n expandiendo-se l universo, sfrecería. Cammin d’un minutu lhœw del Bing Bang, la temperatura baltiaría so un bilhon de graus, approximadamente cien vezes la temperatura l Sol. A esta temperatura, los neutrones intamaríen sfhaese n mas protones. Si todo lo que passare fhuer esto, toda materia n si acabaría cumo l elemento mas cincielho, hydrógëno, cun un nucleu consistente n un proton solu. Per outra parte, delhos neutrones cuttiríen protones, & fundiríen-se formando l próximu elemento mas cincielho, helio, cun un nucleu iguau por dous protones & dous neutrones. Non obstante nun se formaríen elementos cun mas pesu, cumo carbono ou oxýgëno. Ye diffícile afigurase ser possible eguase un systema vivu, mal a penes cun hydrógëno & oxýgëno, quando todu l universo primordial andaba inda calliente por de mas cumo pa combinar átomos in molécules.

stefen h

L universo continuaría expandiendo & arrefreciendo. Cun todo delhes zones tenríen densidahes un pouco mas altes q’outres. L attracçon gravitacional de materia extra n estes zones diría ralentiza’ la expansion, & eventualmente parala. Ente tanto, collapsaríen formando galaxies & strelhes, de magar cerca dous bilhones d’anhos spuœis del Big Bang. Delhes de les primeires strelhes seríen mas massives que l Sol de nuœsso. Seríen mas callientes que l Sol, & queimaríen del hydrógëno & del helio primitivos, resultando elementos cun mas pesu, cumo carbono, oxýgëno & fhierro. A esto mal y vagaríen unos quantos cientos de milhones d’anhos. Spuœis, unes quantes strelhes spanyiríen cumo supernoves, & spardiríen los elementos de pesu tornando al spacio, formando la materia prima de les tandes posteriores de strelhes.

Outres strelhes disten mũîtho cumo pa les poder ver nós directamemente, si tuvieren planetas arrodiando-les. Solo que ciertes strelhes, tyamades pulsares, emitten pulsos regulares d’ondies de radio. Observa-se una pouca variaçon na proporçon dalgunos pulsares, & interpreta-se cumo indicando perturbaçones, por tener planetas circumdantes del vultu la tierra. Los planetas circumdando pulsares nun son susceptibles de tener vida por morrer todolos seres vivos na explosion supernova que fhixzo a la strelha torna-se pulsar. Cun todo, el fheithu d’observase tener unos quantos pulsares planetas indica ser possible na nuœssa galaxia tener tamien planetas una fracçon razonable d’ente cien bilhones de strelhes. Les condiçones planetaries necessaries de la nuœssa fhorma de vida podríen exsistir de magar cerca quattro bilhones d’anhos lhœw del Bing Bang.

El nuœssu systema solar formou-se ha cammin de quattro bilhones & mediu d’anhos, ou cerca diez bilhones d’anhos de puœis del Big Bang, a partir de gas cun contaminaçon de restos de strelhes anteriores. La tierra formou-se por elementos cun mas pesu, incluendo carbono & oxýgëno. Dalguna maneira, daqué d’essos átomos tyigaríen a organizase n fhorma molécules d’ADN. Esto tien la famosa fhorma de doblre heliç, discobierta por Crick & Watson, n una cabanha na sé del New Museum in Cambridge. Connectando les duês cadenes na heliç, ha hi pares d’ácidos nucleícos. Ha hi quattro typos d’ácidos nucleícos, adenina, cytosina, guanina & thiamina. Dá-mi la lherça de nun se’l mîou sythetizador de fhala bon abondo pronunciando los sous nomes. Obviamente, nun se proyectou pa que lu usaren biólogos moleculares. Una adenina n una cadena combina siempre cun una thiamina na outra cadena, & una guanina cun una cytosina. Ansí la sequencia d’ácidos nucleícos n una cadena define una única sequencia complementar, na outra cadena. Les duês cadenes son a xebrase intos & actuar cumo planilhes, eguando outres cadenes. Ansí les molécules d’ADN son a arreproduzi’ la informaçon gënética, codificada nes suês sequencies d’ácidos nucleícos. Secçones de la sequencia son tamien a usase fhaziendo proteínes & outros productos chímicos, que son a executa’ les instrucçones, codificades na sequencia, & fhaer concasa’ la materia prima pol amor d’arreproduzise.

Nun se sabe como les molécules d’ADN appaecierun la primer vez. Les possibilidahes de crease una molécula d’ADN por fluctuaçones aleatories son per-pequenhes. Ha hi xhente q’insinúa por tanto tener venido la vida a la Tierra d’ayures, & que ha hi semientes de vida fluctuando pela galaxia. Ente tanto, nun paeç probable poder sobrevivi’l ADN mũîthu tiempu na radiaçon spacial & magar que podier, nun diba adiudar mũîtho a explica’ la incepçon de la vida, por se’l tiempu disponible de magar la formaçon del carbono mal pouco mas del doblre del tiempu que tien la Tierra.

Una hypóthesis ye que la formaçon dalgo cumo l ADN, que se ye a arreproduzir, ye extremamente improbable. Sí q’ansí n un universo cun una cifra per-grande, ou infinita, de strelhes, podría sperase occurrir n unos poucos systemas stellares, solo q’estos andaríen cun bien de xebra ente sigo. El fheithu d’occurrir vida na Tierra, nun ye surprehendente nin improbable. Mal ye una applicaçon del Principio Anthrópico Flrouxo: Si la vida tuvier appaecido ayures n outru planeta, andábemunos introgando la causa d’appaecer a ende.

Si l appariçon de la vida n un ciertu planeta fhuer per-improbable, podría sperase teney vagaho mũîtho. Mas precisamente, podría-se sperar appaece’ la vida xhusto a tiempo de la subsequente evoluçon a seres sapientes, cumo nós, occurriendo primeiro de la exstincçon, definida pol tiempu vida l Sol. Vagará-y a esso pelos diez bilhones d’anhos, lhœw el Sol inflará & ingulhirá la Tierra. Una fhorma sapiente de vida sería quien a domina’ les travessíes spaciales, & ser quien a scapar a outra strelha. Cun todo, d’outra maneira la vida na Tierra diría star condemnada.

Exsiste evidencia fossil d’haber daqué vida na Tierra, cammin de trés milhones d’anhos & mediu ha. Elho egual fhoi mal a penes 500 milhones d’anhos lhœw de tornase la Tierra stable & fría abondo a fin de pode’ la vida disinvolvese. Solo q’a la vida podría-y tener vagaho siepte bilhones d’anhos el sou disinvolvemiento, & a inda tener tiempu por de mas evolviendo a seres talque nós, que se podríen introgar del intamu la vida. Si la probabilidá de disinvolvese la vida n un planeta ciertu ye per-pequenha, qual fhoi l motivu d’acontecer na Tierra, quasj que n un 14avu l tiempu disponible?

El Surdir ceho de la vida na Tierra indica haber una bona probabilidá de wœnyar spontaneamente la vida, so condiçones adequades. Quiçá houbo una fhorma mas simple d’organizaçon, q’eguare ADN. Al appaece’l ADN sería tan exitoso, que podría tener remplaçades da fheitho les fhormes anteriores. Nun se sabe como seríen esses fhormes anteriores. Una possibilidá ye l ARN: Ye cumo l ADN; solo que mas simple, & sin structura de doblre heliç. Extensiones curties d’ARN son a arreproduzise cumo ADN, & podríen eventualmente eguase cumo ADN. Nun ye possible fhaer ácidos nucleícos n un laboratorio, a partir de material inerte, ente mas ARN. Sí q’ansí dados 500 milhones d’anhos, & oceanos cobriendo lo mas de la Tierra, egual habría una probabilidá razonable d’ARN que s’eguara casualmente.

Cumo ADN que s’autoarreproduz, habríen errores aleatorios. Mũîthos d’essos errores seríen danyibles, & morreríen. Outros seríen neutros. Ye dizir, nun affectaríen la funcçon del gën. Talos errores collaboraríen a una gradual deriva gënética, que paeç occurir cun todeles populaçones. & unos poucos errores seríen favorables al Sobrevivir de la specie. Sbilharíen-se ente elhes por selecçon natural darwiniana.

El processu de la evoluçon orgánica intamou per-sele. Vagou-y dous milhones d’anhos & mediu disindulrcase a partir de les primeires céllules, & outru bilhon d’anhos passar de peixes & reptiles a mammíferos. Solo q’intos la evoluçon paecîu apurase. Mal y vagou quasj q’un milhon d’anhos disinvolvese a partir de los primeiros mammíferos ta nós. La razon ye que los peixes contienen la mayor parte de los wœrganos humanos, & los mammíferos, tienen-los essencialmente todos. Todo lo que se requirîu evolviendo a partir de los primeiros mammíferos, cumo lemures, a humanos, fhoi concasar fino un pouco.

Solo que na raça humana, la evoluçon cuttîu n una etapa crítica, comparable n importancia al disinvolvemiento d’ADN. Esto fhoi l disinvolvemiento de la fhala, & n particular fhala scripto. Elho significa poder passase la informaçon gëneraçon ente gëneraçon, pa tras de gëneticamente, pel ADN. Nun houbo cambio detectable n ADN humano, que se provocare por evoluçon orgánica, nos diez-mil anhos d’historia gravada. Solo que la quantidá de Saber que se passa de gëneraçon ente gëneraçon spoxigou enormemente. L ADN n seres humanos contien pelos trés bilhones d’ácidos nucleícos. Non obstante, bien de la informaçon codificada n esta sequencia ye redundante, ou inactiva & l montante total d’informaçon útile nos nuœssos gënes ye probable ser daqué similar a cien milhones de binarios. Un binario (bit) d’informaçon ye la respuœsta a la intruga sí/no. Por contrastar, una cobierta de papel d’una novella ye a contener dous milhones de binarios d’informaçon. Por tanto, l equivalente humanu de 50 novelles de la editorial Mills & Boon. Una bibliotheca nacional importante ye a contener pelos cinco milhones de lhibros, ou mas ou ménos diez trilhones de binarios. Intos el montante d’informaçon transmittida n lhibros, ye cien-mil vezes mas pa cul ADN.

Ente mas importante ye l fheithu de poder camudase & actualiza’ la informaçon in lhibros intainando mũîtho mas. Vagou-nos delhos milhones d’anhos evolver a partir de simios. Ente tanto n essi tiempu la informaçon útile nel nuœssu ADN mal camudaría probablemente unos poucos milhones de binarios. Intos la taxa de cambio orgánico n humanos, ye cammin del binario per anhu. Por comparança, ha hi quasj que 50.000 lhibros nuœvos que se publiquen n angles cada anhu, continiendo cammin de cien bilhones de binarios d’informaçon. Da cierto, la gran mayoría d’esta informaçon ye broça, & inútile pante qualquiera fhorma de vida. Cun todo, mesmamente ansí, la proporçon d’informaçon útile podiendo addicionase ye milhones, egual bilhones, mayor que pa cun ADN.

Elho quier dizir que s’introu n una phase nuœva d’evoluçon. Al intamu, la evoluçon procedía de selecçon natural, de mutaçones aleatories. Esta phase darwiniana durou pelos trés bilhones & mediu d’anhos, resultando n nós outros, entes que disinvolvierun la fhala, a fin d’intercambiar informaçon. Sí q’ansí nos postreiros diez-mil anhos ou per hi, staríemus no que se y podría tyamar una phase de transmission externa. Ende, la gravaçon interna d’informaçon, transmittida por gëneraçones succesives n ADN, nun camudou significantemente. Solo que la gravaçon externa, in lhibros, & n outres fhormes d’alrmazenase de lharga duraçon, spoxigou enormemente. Ha hi los q’usarán el términu, evoluçon, mal a penes cul material gënético transmittido internamente, & rebattiran l applicalo a informaçon transmittida externamente. Avulta-mi una vision per-strẽitha. Somus mas que los nuœssos gënes solo. Ser nun seremus mas fhuœrtes, ou inherentemente mas sapientes que los nuœssos ancestros coveyos solo que lo que nos strema d’elhos ye l Saber accumulau nos postreiros diez-mil anhos, & particularmente, nos postreiros trés-cientos. Avulta-mi lícito captar una vision mas amplia, & incorporar informaçon transmittida externamente, tamien cul ADN, na evoluçon de la raça humana.

La scala temporal de la evoluçon, na dómina de la transmission externa, ye la scala temporal de l accumulaçon d’informaçon. Indenantea yeren cientos, ou mesmamente miles d’anhos, solo que hagora esta scala temporal ingurrîu so los 50 anhos, ou ménos. D’outra maneira, los cerebros cun que processamus esta informaçon evolvierun solo na scala temporal darwiniana, de cientos de miles d’anhos. Esto intama causar problemas. Nel sieglo XVIII, dizía-se haber un home que llera todolos lhibros scriptos. Non obstante, inguanho, si se lle un lhibru diariu, lhevaría cammin de los 15.000 anhos lle’ los lhibros d’una bibliotheca nacional. Ente tanto, mũîthos mas lhibros se scriben.

Elho quier dizir que nun ha hi quien dominar ma un requeixu pequenhu del Saber humanu, la xhente tien que se specializar, in campos cada vez mas strẽithos. Elho será probablemente una gran limitaçon futura. Da cierto nun podemus continuar mũîthu tiempu cun la tasa exponencial de xorrecer del Saber que tuviemus nos últimos trés-cientos anhos. & cun todo, limitará mas fhuœrte- & minaçantemente les futures gëneraçones tener inda instinctos, & n particular, los impulsos aggresivos que tuviemus na dómina de les cuœves. L aggresion, na fhorma d’oppresion ou de matar outros homes, & quitayos les muyeres & cibeira, fhoi de nidia superioridá na sobrevivencia, ta l tiempu presente, solo q’hagora egual elho sfhai la raça humana inteira & bien del restu la vida na Tierra. Una gerra nuclear ye indagora la minaça mas immediata non obstante haber hi outres, tales que la suœlta d’un virus gëneticamente manipulau ou l effeitu hibernadeiru tornau instable.

Nun ha hi tiempu ya de sperar nós por una evoluçon darwiniana que nos fhaiga mas sabios, & cun meyor predisposiçon. Si q’ansí andamus intrando n una phase nuœva, que podría tyamase evoluçon autodissenyada, u seremus a camudar & a fhaer meyor el nuœssu ADN. Ha hi un proyectu hagora n martsa chartographiando la inteira sequencia l ADN humano. Costará unos quantos bilhones de dóllares, que ye peccata minuta n un proyectu d’esta importancia. Una vez lleídu por nós el lhibru la vida, intamaremus scribiendo correcçones. Al intamu, essos cambios confinarán-se a arreparar defectos gënéticos, cumo fibrosis cýstica & dystrophia muscular. A estos controllen-los gënes únicos, & por ende son enforma fáciles d’identificar & arreparar. Outres qualidahes, cumo intelligëncia, controllen-se probablemente por una gran quantidá de gënes. Será mũîtho mas diffícile atopalos, & manipula’ les relaçones ente sigo. Sí q’ansí, stou ciertu que nel próximu sieglo, la xhente discobrirá como modificar intelligëncia & instinctos cumo l aggresion.

Approbarán-se lheys contra la manipulaçon gënética cun humanos solo que habrá xhente que nun será quien a resjsti’ la temptaçon de fhaer progressar characterístiques humanes tales que l tamanyu la memoîra, resjstencia a la infirmidá & duraçon de la vida. Quando appaecieren los superhumanos, habran grandes problemas políticos cun los humanos que se retrasen, que nun seran a competir. Presumiblemente, exstingiran-se ou tornarán-se irrelevantes. In cuœntes d’elho, habrá una raça de seres autodissenyahos, que progressarán cun una taxa d’evoluçon a infinito.

Si esta raça ye a arredissenyase, reduziendo ou eliminando la minaça de l autodestrucçon, expandirá-se probablemente, & colonizará outros planetas & strelhes. Cun todo, travessíes spaciales a grandes distancies serán diffíciles pante les fhormes de vida que se basen na chímica, tal que l ADN. La extension temporal natural vital d’essos entes ye curtia, in comparança cul tiempu de travessía. A communya cun la theoría de la relatividá, nada ye a deplaçase mas aina que la lhuz, ansí que a la travessía cun retornu a la strelha mas próxima diría-y vagar minimamente oîtho anhos, & ta l centro la galaxia, cammin de los cien-mil anhos. Na sciencia-ficçon, suppera-se esta difficultá cun vórtices spaciales, ou diendo per extradimensiones. Non obstante, nun creho ser possible, tanto dá quan intelligënte la vida se torne. Na theoría de la relatividá, si daqué se ye a deplaçar mas aina que la lhuz, ye a retrodeplaçase n tiempu. Elho provocaría problemas cun xhente diendo retroceder, & camudando l a hieri. Speraría-se tamien ver grandes cifres de touristas del futuro, curiosos por ve’ los nuœssos vezos pinctorescos & antiquahos.

Podría ser possible utiliza’ la manipulaçon gënética fhaziendo que la vida basada nel ADN sobreviva indefinidamente, quando ménos cien-mil anhos. Sí q’ansí una maneira mas fácile q’anda dientro ya quasj de les nuœsses capacidahes, diba ser mandar máchines. Eguaríen-se a fin de durar abondo nes travessíes interstellares. N aportando a una strelha nuœva, podríen pousase n un planeta afheithu, & minar material produciendo mas máchines, que podríen mandase a outres nuœves strelhes. Estes máchines seríen una nuœva fhorma de vida, basada n componentes mechánicos & electrónicos, ma n macromolécules. Seríen a remplaçar eventualmente la vida basada n ADN, cumo l ADN egual remplaçou una fhorma anterior de vida.

Esta vida mechánica podría tamien autodissenyase. Intos paeç que la dómina de transmission externa d’evoluçon mal fhoi a penes un interludio per-curtio, ente la phase darwiniana & la orgánica ou mechánica, phase autodissenyada. Indica-se esto nel diagramma que vien, que nun tien que tener scala, por nun haber maneira de poder amosar un periodu de diez-mil anhos na mesma scala que bilhones d’anhos. Quanto y vagará a esta phase autodissenyada abre-se a questiones. Egual ye instable, & la vida sfhai-se elha mesma, ou martsa scontra un cammin sin salida. Si esso nun tyega, sería a sobrevivi’ la muœrte l Sol in cinco bilhones d’anhos, mudando-se a planetas al rodiu d’outres strelhes. Les mas de les strelhes exstingiríen-se n outros quinze bilhones d’anhos mas ou ménos, & l universo approximaría-se a un stadio de completu tracamundio a communya cun la Segunda Lhey de la Thermodynámica. D’outra maneira Freeman Dyson demonstrou que magar esto, la vida ye a adaptase a la diminuçon continua d’approvisionamiento d’energìa & intos in principio ye a continuar siempre.

Quales diben se’ les possibilidahes d’atopanos cun daqué fhorma de vida extraterrestre explorando la galaxia? Si l argumento de la scala temporal del wœnyar de la vida na Tierra ye correcto, ergo podríen, in principio, haber mũîthes outres strelhes, cun los sous planetas teniendo vida n elhos. Daqué d’essos systemas stellares formaríen-se cinco bilhones d’anhos primeiro que la Tierra. Intos, como ye que la galaxia nun anda fherviendo cun fhormes de vida autodissenyada mechániques ou orgániques? Como ye que la Tierra nun tien nunca sido vjsitada, & nunca colonizada? Nun cuœnto cun propuœstes que contienen los OVNI cumo entes del spacio exterior. Pienso que qualquiera vjsita por extraterrestres diría8 ser mũîtho mas obvia, & probablemente tamien, mũîtho mas disagradable.

Quala ye la explicaçon de que ye que nun se nos vjsitou? Una hypóthesis ye se’l argumento sobre l Wœnyar de la vida na Tierra incorrecto. Egual la probabilidá d’appaecer vida spontaneamente ye tan baxa, que la Tierra ye l únicu planeta na galaxia, ou nel universo observable, u appaecîu. Outra hypóthesis ye haber una probabilidá razonable de formase systemas autoarreproduzibles, cumo céllules, por ende les mas d’esses fhormes de vida nun acaben n intelligëncia. Aveza-se pensar na vida intelligënte cumo inevitable consequencia de la evoluçon, sí q’ansí l Principio Anthrópico tenría que nos avisar de sfhoutanos d’argumentos talos. Ye mas probable se’ la evoluçon un processu aleatoriu, cun intelligëncia cumo daqué d’una gran quantidá de possibles effeitos. Nun ye nidio tene’ la intelligëncia valor de sobrevivencia a lhargu términu. Bacteries, & outros organismos unicellulares, continuaríen viviendo si toda la outra vida na Tierra s’annichilare poles nuœsses acçones. Ha hi sofhitu a la oppinion de que la intelligëncia fhoi un disindolrcu improbable de la vida na Tierra, a partir del cómputu de la evoluçon. Vago-y mũîtho, dous bilhones & mediu d’anhos, dir de seres unicellulares a pluricellulares, que son un necessariu precursor de la intelligëncia. Ye una bona fracçon del tiempu total disponible, inantea de spanyi’l Sol. Intos sería consistente cun la hypóthesis que la probabilidá de disinvolve’ la vida intelligëncia ye baxa. N esti casu, speraríemus atopar mũîthes outres fhormes de vida na galaxia, por ende ye remoto atopanos cun vida intelligënte. Outra maneira, na que la vida nun sería a disinvolver ta una etapa vida intelligënte, diba ser si un asteroide ou cometa cuttier el planeta. Acabantes andamus d’observa’ la collision d’un cometa, Schumacher-Levi, cun Xhúpiter. Eguou una riestra de boles enormes de fhœw. Piensa-se se’ la responsable de la exstincçon de los dinosaurios la collision d’un cuœrpu celeste per-pequenhu cun la Tierra ha pelos 70 milhones d’anhos. Unos poucos mammíferos primitivos sobrevivierun, sí q’ansí todo del vultu d’un persona da cierto quedaría annichilaho. Ye diffícile predizi’ la frequencia de la occurencia d’estes collisiones, por ende una speculaçon razonable diría ser cada 20 milhones d’anhos de media. Si esta cifra ye correcta, diba querer dizir tenese disinvuœlto la vida na Tierra solo por suœrte de nun tener tenido collisiones series nos últimos 70 milhones d’anhos. Outros planetas na galaxia, nos que se disinvolvier la vida, podríen nun tener un periodu lhargu abondo lhibre de collisiones cumo pa permitti’ la evoluçon a seres intelligëntes.

La tercer possibilidá ye haber una probabilidá razonable de formaçon de vida, & d’evoluçon nos seres intelligëntes na phase d’evoluçon externa. Solo que n esti punctu l systema torna-se instable, & la vida intelligënte destrui-se a si mesma. Sería una per-pessimista conclusion. Deseo mũîtho que nun sea verdadeira. Prefiero una quarta possibilidá: habría outres fhormes de vida intelligënte ayures solo que nos andaríen passando per alto. Había un proyectu tyamau SETI, na geta de vida sapiente extraterrestre. Involucraba explorar radiofrequencies por ver si seríemus a appanyar sinyales de civilizaçones extraterrestres. Avultou-mi valir esti proyectu la pena sofhitalu, magar cancellase por falta fondos. Cun todo, hemus ser mas roceanos a la hora de responder, ta evolver un pouco mas. Atopanos cun una civilizaçon mas adelantrada, na etapa presente, podía ser un pouco cumo los habitantes primitivos d’Ámerica al atopase cun Colon. Nun creho que fhueren elhos meyores.

Esso ye todo lo que tengo que dizir. Agradecidu por ascuîthame.

Fhonte:

http://www.hawking.org.uk/life-in-the-universe.html

Repta’l pensamiento reconhocido ye fundamental al resolver problemas

Audio:

Niels Bohr, l adversariu que ménos se conhoç d’Einstein, mereç abonda mas attençon.

Un de los dous scientíficos de referencia participantes n una riestra debattes d’ente gerres pola philosophía de la sciencia ye icónicu. Albert Einstein ye famosu n todo l mundo, quanto si mas pante xhente que nunca comprehendiera les theoríes de sou. Al sou colhaçu nes disputes intellectuales de los 1920’s & 30’s, contrariamente, conhoç-se-lu immerecidamente pouco.

Magar ganha’l premio Nobel de phýsica & ser mas q’un adversariu d’Einstein, Niels Bohr anda lhuönye de tene’l renome que se mereç poles suês conquistes. Trespassando la sciencia, les suês idees na educaçon, specialmente infhoutando-se na la mocidá q’impulsa les lhendes del Saber, inspiren a professores & studiantes.

Bohr nacîu n Dinamarca n 1885, yera talentosu ta ya de pequenhin. Tamien xhogara n un equipu la lhiga danesa & pa de tras tocara ta la fabricaçon de vidro al nun attende’ les suês necessidahes los tubos de test d’un laboratorio universitario.

In 1911, andaba n Anglaterra n una communidá scientífica, devorando nuöves investigaçones na sphera l átomu. Dous anhos mas tarde, ponría-se al frente de la phýsica quántica, creando l modello atómicu que se diba torna’ la base de la nuössa comprehension de la construcçon del mundo. Ganhou l premio Nobel in 1922 & intamou la griesca pública cun Einstein por un assumptu que probablemente deixaría al commun de los mortales ximielgando la cabeça: la non-localidá quántica.

Los sous alderiques son vistos cumo una de les marques d’awa de la investigaçon scientífica de la primer media parte l sieglo XX. Un cambio d’eleiçon fhixzo a Einstein discharta’ la theoría de tener que s’intende’ la mechánica cumo probabilidá n sin explicaçon causal, diziendo tener elhi la certeza de que Dîous nun anduviera xhogando a los dados. Bohr respondîu: “Valîu ya de dizir a Dîous lo que tien fhaer”.

In 1921 abrîu l Instituto Niels Bohr, una vez que passaran quattro anhos ganhando l sofhitu l gubierno danes & appanyando financiamiento d’impreses & de donantes privativos que lu deixaríen eguar un centro d’excelencia pante una nuöva fhornada de phýsicos.

El sou instituto na Universidá de Köbenhavn tornou-se quasj q’una lhinya de producçon de phýsicos de Premios Nobel. Quattro de los sous miembros recibierun la honra suprema, ente elhos un de los seys fhiyos de Bohr.

El trabayu l instituto amoldou l mundo. Tenemus a Bohr & a los sous discípulos que yos agradece’l importante progressu de la mechánica quántica. Si esto sona cumo a zafarrantsu scientíficu, tentai pensar na vida n sin electrónica nel muxicu de los computadores, de los teléphonos móbiles, dispositivos de CD, de los lasers & scanners médicos. Essos dispositivos, & mũîthos outros mas, gasten de la téchnica que spoxigou de magar les pesquises de Bohr. L instituto menta un studio affirmando que l 30% del PIB del mundo occidental ye possible traçalu ta l pensamiento de Bohr.

La razon subiacente de les conquistes del instituto de Bohr ye daqué que les schuöles de negocios & los studiantes fharíen bien n anotar. Nun fhoi denheiro la garantía l éxitu. Lo que fhixzo la differencia fhoi l infhoutu por questiona’l pensamiento reconhocido pola mocidá que vien marcando l cammin. Bohr demonstrou infhoutu n nuövos scientíficos q’outres figures ya bien stablicides vieran star inda abondo verdes cumo por poder s’infhoutar n elhos da fheitho.

Una approximaçon u les innovaçones & l enthusiasmu de la mocidá todo beneficia podía ser un paradigma pa gran parte de la educaçon de la xhente n Poder. Si la xhente moço tuvier l’infhoutu de fhae’ les couses de maneira differente, dibemus ser quien a approximanos a la soluçon de problemas cumo polluçon, consumu energïa, secques & falta cibeira. La schuöla negocios ye un sitiu ideal u semar una philosophía del typu.

D’ascendencia hebrea & trabayando na Dinamarca occupada polos nazis, un scientíficu notable cumo Bohr nun podía scapar a les attençones del Reich. Evitando que los nazis confiscaren duês medalhes Nobel d’ouro que se dieran a collegas xhudíos, Bohr & un chímicu danes decidierun, pelligrando enforma, dissolveles, scondiendo-les n un vasu de líquido color ocre inantea tyiga’ les tropes & arrebuscar pel sitiu (Bohr sacara a puya la suâ propria medalha pal sofhitu de gerra fines indenantea la invasion). N un épilogu notable, n acabando la gerra, el chímicu invertîu l processu & mandou l ouro a la Fundaçon Nobel, q’arrefhairía les medalhes apresentando-les a los vencedores del premio.

Bohr continuou adiudando a los que scapaben de los nazis & intos, n emittiendo-se l mandato de prender xhudíos in Köbenhavn na seruönda de 1943, scapou a la Gran Bretanya por adiudar a les fhuörçes Aliades a assumi’ la delantreira na carreira atómica.

El sou instituto indagora prospera & tien una plraca que declara se’l edificio u la phýsica atómica & la phýsica moderna nacierun, n un ambiente creativu special que s’inspirou por Niels Bohr. Magar ser bien cierta esta sobria affirmaçon, nun y fhai la xhusticia adequada a una figura que sta subestimada.

Fhonte:

https://www.ft.com/content/e44afff6-8b88-11e7-9084-d0c17942ba93

    Haplogruppo I-M253

    L haplogruppo I-M253, conhoç-se-lu tamien cumo I1, ye un haplogruppo l chromosoma Y. Los marcadores gënéticos confirmantes cumo identificadores de I-M253 son los SNPs M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L 125/S65, L157.1, L186, e L187. Ye l principal ramal l haplogruppo I-M170 (I*).

    L haplogruppo cutte l sou picu frequencial in Suecia (52% de los homes nel Condau de Västra Götaland) & de Finlandia occidental (trespassa l 50% na provincia de Satakunta). In términos de medies nacionales, I-M253 atopa-se n 35-38% de los homes suecos, 32,8% de los daneses, cammin de 31,5% de los norvegos & cerca de 28% de los fineses de sexu masculin.

    L haplogruppo I-M253 ye l principal ramal l haplogruppo I* (I-M170), presente n Europa de magar tiempos antiguos. El principal ramal de I* ye l I-M438, tamien se conhoç cumo I2.

    Lhöw d’arreclassifica-se 2008, al haplogruppo conhocía-se-lu cumo I1a, un nome que ya se y attribuera a un ramal primariu, l haplogruppo I-DF29. Los outros ramales principales d’ I1 (M253) son I1b (S249/Z131) & I1c (Y18119/Z17925).

    Indiç

    Procedencia

    Segun un studio que se publicou n 2010, l I-M253 formou-se ha ente 3,170 & 5,000 anhos, nel periodu Chalcolíthicu n Europa. Un nuövu studio, in 2015, estimaba la procedencia de 3,470 a 5,070 anhos ha, ou ente ha 3,180 & 3,760 anhos, gastando duês téchniques differentes. Paeç sparcese inicialmente del territorio que ye wöy Dinamarca.

    Un studio de 2014, n Hungría, revelou restos de nuöve specímenes de la Cultura la Cerámica Bandes, un d’ente elhos lhevando l SNP M253 definitoriu l haplogruppo I1. Piensa-se star esta cultura presente d’ente 6.500 a 7.500 anhos ha.

    Structura

    I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L 125/S65, L157.1, L186, e L187) ou I1

    • I-DF29 (DF29/S438); I1a

      • I-CTS6364 (CTS6364/Z2336); I1a1

        • I-M227; I1a1a

        • I-L22 (L22/S142); I1a1b

          • I-P109; I1a1b1

          • I-L205 (L205.1/L939.1/S239.1); I1a1b2

          • I-Z74; I1a1b3

          • I-L300 (L300/S241); I1a1b4

            • I-L287

              • I-L258 (L258/S335)

            • I-L813

      • I-Z58 (S244/Z58); I1a2

        • I-Z59 (S246/Z59); I1a2a

          • I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1

            • I-Z140 (Z140, Z141)

              • I-L338

              • I-F2642 (F2642)

            • I-Z73

              • I-L1302

            • I-L573

            • I-L803

          • I-Z382; I1a2a2

        • I-Z138 (S296/Z138, Z139); I1a2b

          • I-Z2541

      • I-Z63 (S243/Z63); I1a3

        • I-BY151; I1a3a

          • I-L849.2; I1a3a1

          • I-BY351; I1a3a2

              • I-CTS10345

                • I-Y10994

              • I-Y7075

          • I-S2078

            • I-S2077

              • I-Y2245 (Y2245/PR683)

                • I-L1237

                  • I-FGC9550

                • I-S10360

                  • I-S15301

                • I-Y7234

          • I-BY62 (BY62); I1a3a3

    • I-Z131 (Z131/S249); I1b

      • I-CTS6397; I1b1

    • I-Z17943 (Y18119/Z17925, S2304/Z17937); I1c

    Distribuçon territorial

    I-M253 atopa-se na so mayor densidá al norte d’Europa & d’outros payses que suffrieran intensa migraçon d’Europa l norte, bien nel Periodu de Migraçon, bien in periodu vikingu ou bien in tiempos modernos. Atopa-se n todolos sitios q’invadierun los vieyos puöblros gërmánicos & vikingos.

    Na dómina moderna, populaçones significatives del I-M253 tamien grilharun nes naçones d’immigrantes & excolonies europees, tales cumo los USA, Australia & l Canadá.

    poblaçon

    Tamanyu patron I (total) I1 (I-M253) I1a1a   (I-M227) fhonte
    Austria 43 9.3 2.3 0.0 Underhill et al. 2007
    Russia-Blranca: Vitebsk 100 15 1.0 0.0 Underhill et al. 2007
    Russia-Blranca: Brest 97 20.6 1.0 0.0 Underhill et al. 2007
    Bosnia 100 42 2.0 0.0 Rootsi et al. 2004
    Bulgaria 808 26.6 4.3 0.0 Karachanak et al. 2013
    República Checa 47 31.9 8.5 0.0 Underhill et al. 2007
    República Checa 53 17.0 1.9 0.0 Rootsi et al. 2004
    Dinamarca 122 39.3 32.8 0.0 Underhill et al. 2007
    Anglaterra 104 19.2 15.4 0.0 Underhill et al. 2007
    Estonia 210 18.6 14.8 0.5 Rootsi et al. 2004
    Estonia 118 11.9 Lappalainen et al. 2008
    Finlandia (nacional) 28.0 Lappalainen et al. 2006
    Finlandia: Oeste 230 40 Lappalainen et al. 2008
    Finlandia: Este 306 19 Lappalainen et al. 2008
    Finlandia : Satakunta 50+ Lappalainen et al. 20089
    Francia 58 17.2 8.6 1.7 Underhill et al. 2007
    Francia 12 16.7 16.7 0.0 Cann et al. 2002
    Francia (Baxa-Normandía) 42 21.4 11.9 0.0 Rootsi et al. 2004
    Allemania 125 24 15.2 0.0 Underhill et al. 2007
    Grecia 171 15.8 2.3 0.0 Underhill et al. 2007
    Hungría 113 25.7 13.3 0.0 Rootsi et al. 2004
    Irlandia 100 11 6.0 0.0 Underhill et al. 2007
    Kazan Tártaros 53 13.2 11.3 0.0 Trofimova 2015
    Letonia 113 3.5 Lappalainen et al. 2008
    Lituania 164 4.9 Lappalainen et al. 2008
    Paises Baxos 93 20.4 14 0.0 Underhill et al. 2007
    Norvegia 2826 31.5 Eupedia 2017
    Russia (nacional) 16 25 12.5 0.0 Cann et al. 2002
    Russia
    Pskov
    130 16.9 5.4 0.0 Underhill et al. 2007
    Russia Kostroma 53 26.4 11.3 0.0 Underhill et al. 2007
    Russia Smolensk 103 12.6 1.9 0.0 Underhill et al. 2007
    Russia Voronez 96 19.8 3.1 0.0 Underhill et al. 2007
    Russia Arkhangelsk 145 15.8 7.6 0.0 Underhill et al. 2007
    Russia Cossacos 89 24.7 4.5 0.0 Underhill et al. 2007
    Russia Carelios 140 10 8.6 0.0 Underhill et al. 2007
    Russia Carelios 132 15.2 Lappalainen et al. 2008
    Russia
    Vepsos
    39 5.1 2.6 0.0 Underhill et al. 2007
    Slovaquia 70 14.3 4.3 0.0 Rootsi et al. 2004
    Slovenia 95 26.3 7.4 0.0 Underhill et al. 2007
    Suecia (nacional) 160 35.6 Lappalainen et al. 2008
    Suecia (nacional) 38.0 Lappalainen et al. 2009
    Suecia: Västra Götland 52 Lappalainen et al. 2009
    Suiça 144 7.6 5.6 0.0 Rootsi et al. 2004
    Turquía 523 5.4 1.1 0.0 Underhill et al. 2007
    Ukrania Lvov 101 23.8 4.9 0.0 Underhill et al. 2007
    Ukrania Ivanovo-Frankov 56 21.4 1.8 0.0 Underhill et al. 2007
    Ukrania Hmelnitz 176 26.2 6.1 0.0 Underhill et al. 2007
    Ukrania Tcherkássi 114 28.1 4.3 0.0 Underhill et al. 2007
    Ukrania Belgorod 56 26.8 5.3 0.0

    Underhill et al. 2007

    Gran Bretanya

    Mappa amosando la distribuçon de chromosomas Y n una secçon transversal d’Anglaterra & Pays de Gales, del trabayu “Chromosoma Y: evidencia de migraçon massiva d’anglo-saxones“. los auctores attribuen les differencies in frequencies del haplogruppo I a la migraçon anglo-saxona n massa pa Anglaterra, magar nun ser ansí n casu l Pays de Gales.

    In 2002 asoleyou-se un artículu scriptu por Michael E. Weale & collegas presentando evidencia gënética de differencies ente les poblaçones anglesa & galesa, incluendo un nivel porcentual perciptiblemente mas altu d’haplogruppo I-ADN n Anglaterra que n Pais de Gales. Vîu-se esto intos como una evidencia convincente d’invasion anglosaxona massiva del oriente de Gran Bretanya a partir del norte d’Allemania & Dinamarca, pel Periodu de Migraçon. Los auctores assumen fundase les poblaçones cun fhuörtes proporçones d’haplogruppo I n Allemania l norte ou nel sur Scandinavia, sobre maneira n Dinamarca, & migra’ los sos antepassahos pel Mar del Norte cabo les migraçones anglosaxones & vikinges daneses. La principal revindicaçon de los investigadores fhoi

    ser necessaria d’aquelha un eventu d’inmigraçon anglosaxona affectando al 50-100% del fhundu gënéticu de los homes de l Anglaterra central. Observamus, ente tanto, nun mos deixar differencia’ los nuössos datos un eventu que cincielhamente s’addicionou al fhundu hereditariu autochthone de los homes de l Anglaterra central, d’outru u a los homes autochthones los tuvieren dexebrahos ayures ou onde a los varones nativos los tuvieren reduzidos in númeru… Esti studio amuösa se’ la raya galesa mas una barreira gënética pal chromosoma Y & pal fluxu gënes anglo-saxon que l mesmu Mar del Norte… Estos resultahos indiquen ser una fronteira política mas importante q’una gëophýsica n una structuraçon gënética de la poblaçon.

    Distribuçon los haplogruppos del chromosoma Y de Capelli et al. (2003). L haplogruppo I anda presente n todeles populaçones, cun les frequencies mas altes n oriente & baxes n occidente. Paeç nun haber una discontinuidá na lhende cumo apercibido por Weale et al. (2002)

    In 2003, un artículu asoleyau por Christian Capelli & collegas sofhitou, magar que modificades, les conclusiones de Weale & collegas. Essi trabayu, que presentou specímenes de Gran Bretanya & d’Irlanda n planilha, atopou una minor differencia ente amuöstres galeses & angleses, cun una diminuçon gradual na frequencia l haplogruppo I diendo cara a occidente nel sur de la Gran Bretanya. Los resultahos indiquen a los auctores tener influido a sgaya los invasores vikingos norvegos na parte norte de les Islles Britániques, magar tener todeles amuöstres angleses & scoceses de la Gran Bretanya influencia allemana &/o danesa.

    Miembros proeminentes del I-M253

    Alexander Hamilton, por stirpe & pruöba gënética de los sous descendientes (afigurando-se cumo cierta la paternidá que y correspuönde pola suâ stirpe), mangou-se-lu dientro l haplogruppo Y-ADN I-M253.

    Birger Jarl, ‘Duque de Suecia” de la Casa los Godos de Bjalbo, fundador de Stocolmo, cun los sous restos que s’inhumarun n una eglresia & s’atoparun el 2002, resultou ser I-M253.

    Occupantes del Mayflower William Brewster, Edward Winslow & George Soule per pruöbes de ADN

    Marcadores

    ADN: modello: cadena 1 diffier de la cadena 2 n un únicu par de base local (un C >> T del polymorphismu).

    Les que vienen son les specificaçones téchniques de les mutaçones de los SNP & STR conhocidos del haplogruppo I-M253.

    Nome: M253

    Typu: SNP
    Fhonte: M (Peter Underhill de la Universidá de Stanford)
    Posiçon: ChrY:13532101..13532101 (+ cadena)
    Posiçon: (pares de base): 283
    Tamanyu total (pares de base): 400
    Extension: 1
    ISOGG HG: I1
    Iniciador molecular F (speyu 5’→ 3′): GCAACAATGAGGGTTTTTTTG
    Iniciador molecular R (complementar 5’→ 3′): CAGCTCCACCTCTATGCAGTTT
    YCC HG: I1
    Alteraçon nucleotideos allelos (mutaçon): C por T

    Nome: M307

    Typu: SNP
    Fhonte: M (Peter Underhill)
    Posiçon: ChrY:21160339..21160339 (+ cadena)
    Extension: 1
    ISOGG HG: I1
    Iniciador molecular F: TTATTGGCATTTCAGGAAGTG
    Iniciador molecular R: GGGTGAGGCAGGAAAATAGC
    YCC HG: I1
    Alteraçon nucleotideos allelos (mutaçon): G por A

    Nome: P30

    Typu: SNP
    Fhonte: PS (Michael Hammer , de la Universidá d’Arizona & James F. Wilson, de la Universidá d’Edinburgo)
    Posiçon: ChrY:13006761..13006761 (+ cadena)
    Extension: 1
    ISOGG HG: I1
    Iniciador molecular F: GGTGGGCTGTTTGAAAAAGA
    Iniciador molecular R: AGCCAAATACCAGTCGTCAC
    YCC HG: I1
    Alteraçon nucleotideos allelos (mutaçon): G por A
    Regio: ARSDP

    Nome: P40

    Typu: SNP
    Fhonte: PS (Michael Hammer & James F. Wilson)
    Posiçon: ChrY:12994402..12994402 (+ cadena)
    Extension: 1
    ISOGG HG: I1
    Iniciador molecular: GGAGAAAAGGTGAGAAACC
    Iniciador molecular R: GGACAAGGGGCAGATT
    YCC HG: I1
    Alteraçon nucleotideos allelos (mutaçon): C por T
    Regio: ARSDP

    Bancos de datos haplogruppo I