“The Model” – prototypu de Kraftwerk del pop modernu

El hit de la banda de Düsseldorf demonstrou l poder se’ la electrónica emocional.

La vida d’una música

“Ye una modello & ye curiosa” In febreiro 1982, el sophisticau & insulsu Ralf Hütter de Kraftwerk pairaba cumo un dron in riba d’un UK top 10 que incluyía Bucks Fizz & Shakin’ Stevens. “The Model” sacou-se nel album clássico de la banda de 1978 The Man Machine, pero EMI arreviviera’l cantar cumo cara-B de “Computer Love” (recyclau nel cantar “Talk” por Coldplay  nel sou album de 2005).

Los pintschas preferíen “The Model”, ansí que l selho lu arreditou cumo doblre cara-A & creou l primer númeru 1 d’una banda inteiramente allemana – non obstante, cumo xhente moço de la cosmopólita Düsseldorf, Kraftwerk identificaba-se mas cumo “una banda europea con passaportes allemanes”.

La historia de Kraftwerk intamou al incontrase Hütter cul flautista & “fetitschista l son” Florian Schneider na schuela de música acabantes los 60’s. La suâ “musica folk industrial europea” fhoi inspirada pol compositor electrónicu pioneiru Karlheinz Stockhausen & la mission de los artistas italianu & angles per-elegantes Gilbert & George de “trahe’ l arte a la vida diaria”. Veniendo d’una familia bien culta & rica, Schneider comprára un synthetizador, quando l sou valor andaba fhuera l algame la mayoría los músicos.

A los críticos británicos & americanos costou-yos acceitar sones synthéticos (Lester Bangs tyamou-lo “soluçon final” de la música de Kraftwerk), pero aina fhueran fhorçaus a admittir que les prestancies de la rutina & la elegante sinhalrdá de los panoramas sonoros prístinos andaben arresonando na xhente moço.

“Ye emocional” Hütter explicaba ceho aquel anhu. “Quanto ha ya que la xhente tien difficultaes pa atopar sensibilidá na electrónica. Pero quando vas al doctor & ti fhai un test de coraçon, ye la electrónica la que ye sensible. Ser, ye ermano cun un instrumento. Ye polo que hemus usa’ les fherramientes de la sociedá de wey al crear música – d’outra maneira nun ye ma daqué vieyo”.

“Das Model” (na suâ version allemana primitiva) salîu d’un poema que l collaborador artísticu de la banda Emil Schultz scribiera poles modellos de l alta-moda que observára n una boîte de Colonia. Delhes feministas clamen que l cantar cousifica l sou subiectu: una muyer mal exsistiendo por ser vista a penes por un home, sorriendo por denheiro. Defenden-lo outros cumo crítica de la sociedá consumu que reduz les muyeres a autómatas sin nome.

Siendo cumo ye un cantar d’un ser humano, ye nidio que ye una rareza nel catálogu d’una banda que s’afhai mas a gusto a l architectura & a la téchnica. Cumo se burllára un fan blogger: “Scaeicéi l Test Bechdel; la mayoría los themas de Kraftwerk nin passen el Test de Turing“.

Pero nun ha hi debatte dalu del Poder captativu del gantschu matschacon & de la melodía fhalisposa del cantar. (Pa los geeks, probablemente ye un Micromoog al baxu, un Polymoog al puncteu & un Minimoog intrando a 1:30, pero la banda ye abondo secretiva no que toca a les fherramientes de sou). Kraftwerk ye possible que dispreziaren les lhistes, pero dierun el prototypu de pop modernu.

Devotos versionarun el cantar in quajsi que qualquier stylu concibible. YouTube reproduz versiones d’alcordionistas fineses… .

…enxames de música de cámara medievales…

…ensembles d’ukulele…

 & bandes klezmer…

Los punks de Surrey The Members (fhoi viral in 2015 l sou thema de 1979 de protesta “Offshore Banking Business” cumo respuesta al scándalo de los “Papeles de Panamá”) daben-y una remocicada respaldada con una secçon de metal de reggae n 1983.

The Balanescu Quartet gastou de chuerda clássica cul aciu de replicar toles seqüencies de synthetizador nel sou album del 1992 acabante reditar, Possessed, & tocarun el cantar in vivo con David Byrne; pal alleccionamiento definitivo na dança robótica.

Los metállicos industriales allemanes Rammstein streldaben el thema tyigando a la obliteraçon in 1997…

…al in par la banda independiente sueca The Cardigans ousaben mangay un effeitu clavicémbalo n 2003.

Lo primitivo sí que ansí probou-se imbattible. Nel tour de 2017, Kraftwerk arreforçou outru material con dançes modernes, pero deixou “The Model” tal qual. Cumo l sou subiectu, el cantar remaneç intocable.

Lhista reproducçon:

La traiçon de los intellectuales: tscharranerìa pedante

Acabante septiembre 1971 Karl Raimund Popper publicou n ZEIT un textu que se hôubiere dar cumo lectura oblrigada a cada studiante wey. N esti textu posiciona-se contra la dishonestidá intellectual, la traiçon d’hypothéticos intellectuales que scuenden los sous pensamientos valeiros cun pallabres ermanes a la vez que bayuroses. Particularmente, lo que Adorno & Habermas fhexzieran acabada la segunda gerra mundial de la Schuela de Frankfurt, val-y a Popper cumo traiçon de los intellectuales. Citamus la suâ contribuçon in ZEIT & complementamus-la cun una version mas detalhada de Popper in 1984 so l títulu “Gegen die großen Worte” (Contra les pallabrones) – (Una charta que nun fhuera pensada cul aciu de publicase) stampada nel lhibru “Auf der Suche nach einer besseren Welt” (A la geta d’un mundo meyor).

Que yos preste a los nuessos lectores esti textu n una dómina na que la verborhea pedante paeç substituyir in gran parte a la declaraçon falta conteníu, siendo mas actual agora que nunca:

“Lo que you tyamára peccaho contra l Spíritu Sanctu – la pedantería del “illustrau trés-quartos”, ou seya, el trilhador de tópicos, presumiendo Saber que nós outros nun tenemus. La receita ye: tautonomíes & caxigalines adobades cun absurdidá paradoxal. Outra receita ye: scribir rimbombancia dura de comprehender & addicionar da quando caxigalines. Esto y presta al lector, acombayau por atopar n un lhibru talos pensamientos “profundos” que mesmamente da quando pensara pa si. (Cumo qualquiera ye a ver wey – la roupa nuevo del imperador fhai moda!).

In tyigando a la universidá, un studiante nun sabe que normes s’applicar. Por tanto adopta les normes que atopa. Una vez que les normes intellectuales na mayoría les schueles de philosophía (& specialmente n sociotéchnia) acceiten lo rimbombante & el Saber pretendíu (Toda essa xhente paeç saber mũîtscho), tornen-se tamien da fheitscho bones cabeces inrevesades. & los alumnos que s’irriten poles falses pretensiones de la philosophía “dominante” tornen-se cun razon oppositores de la philosophía. Piensen erroneamente ser usurpaçones de la “classe dominante” & que una philosophía cun influyencia de Marx diría fhaelo meyor. Pero l “polhin” modernu manzorgu ye normalmente mas atravesau inda que l “retueyin” de dreitsches.
[…]
Magar quajsi que sempre trabayar you n problemas scientíficos bien definidos, tol mîou trabayu passa per un fhilu conductor: pro argumentos críticos – contra pallabres valeires & contra la immodestia intellectual & la presumpçon – contra la traiçon de los intellectuales, cumo lo tyamára Julien Benda. Sou del convencimiento que nós outros – los intellectuales – quajsi que somus culpables de cada lhaceîria, por lhuîtschar bien pouco pola honestidá intellectual. (Al cabu, ente tanto l anti-intellectualismo necio probablemente martschará cun la victoria). In “Open Society” digo-lo n una centena de differentes attaques contra los falsos prophetas, & nun me duelen prendes.

Queredes saber, ou esso paeç, quales son les razones poles que you nun quiero discutir cul professor Habermas…

Ende les miês razones. Consisten (1) in cites de “Positivismusstreit” (Disputa l Positivismo) del professor Habermas, de magar l intamu la suâ addenda a la controversia ente Popper & Adorno (nota bene, ta l 26 março 1970 nunca publicara you una pallabra contra Adorno ou Habermas) & ( 2) de les miês traducçones. A delhos lectores avultará-yos nun tener sido you quien a traduzir adequadamente l textu básicu. Possible menos seya. Sou un traductor abondo experimentau, pero igual pal lhabor esti, sou fatu por de mas. Como fhuere, fhixci-lo cumo meyor pudi:”
[…]

Habermas intama cun una cita d’Adorno, al que cumplrimenta (tyana 155).

Cites del ensayu de Habermas

La miâ traducçon (Popper)

El total de la sociedá nun conduç una vida propria per riba de lo que elha combina, de lo que elha mesma consta.

La sociedá fundamenta-se n relaçones sociales.

Elha produz & reproduz-se polos sous momentos individuales

Les diverses relaçones dalguna maneira produzen la sociedá.

Bien pouco del todo de la vida, de la coperaçon & del antagonismo ye a xebrase del individuo,

So estes relaçones atopen-se  coperaçon & antagonismo; & al constar (como dixi) la sociedá d’esses relaçones, nun ye a xebrase d’elhes;

Tamien tan pouco se ye a comprehender qualquier elemento solo nel sou comportamiento n sin una comprehension de la totalidá que tien la suâ essencia nel movimiento del individuo mesmo.

Pero tamien passa lo contrario: dala relaçon ye a comprehendese n sin les outres.

El systema & la individualidá son recíprocos & solo ha hi que los comprehender reciprocamente.

(Repetiçon de lo anterior)

Adorno interpreta la sociedá n categoríes que nun niegen la suâ fhonte nel raciocinio de Hegel.

Adorno usou una expression que recuerda a Hegel.

Interpreta la sociedá como un todo n sentíu strictamente dialécticu, que prohibe considera’l todo organicamente dependiente de la phrase: ye mas que la summa les partes;

Nun diz (sic) cun esto que l todo ye mas que la summa les suês partes.

Inda menos ye l todo una classe que sea a determinase cun un raciocinio comprehensivo por una combinaçon de tolos elementos que gasta,

Inda menos ye (Sic) el todo una classe d’elementos.

“El total de les interrelaçones de la vida social…”

Todos andamus dalguna maneira interrelacionaus …

Les theoríes son schemas que iguamus arbitrariamente n spacio syntácticamente vinculante.

Les theoríes han de ser formulades de fhorma grammatical;  d’outra maneira podemus dizi’ lo que queramus.

Resulten útiles n una staya themática specífica quando se yos axhuncta la multiplicidá real.

Son applicables a una staya specífica quando ye applicable.

“El xhouew brutal, daqué simple habelo d’expressar cun ingedeyu & lo insubstancial expressalo difficil, consideren-lo tradicionalmente mũîtschos sociólogos, philósophos etc… infelizmente cumo l sou Deber official. Ansí lo apprehendieran, & ansí lo apprehenden a outros”

Ta agora cun Popper.

De magar fhoi acabada esta traducçon de Habermas, u se pierde mũîtscha rimbombancia al reduzila a les caxigalines expressades realmente por elhi, ou  – fhalando cun Fox Mulder: “al dizilo sona como puxarra” – passou mũîtschu tiempu. Lo apotheósico n esti tiempu nun fhoi a menos, fhoi a mas, & camudou. Por esso fhalamus meyor de verborhea pedante. Popper andaba inda cun los pedantes de bones quando habíen dizir caxigalines. Wey ye outra cousa. Non solo caxigalines, ma fórmules valeires, pallabrería n sin xacíu, discarga linguística empaquetada de tala maneira que paeç ser phrases, de les que l conteníu scapa. Por tanto avulta-nos wey el términu “verborhea pedante” el mas appropriau refiriendo-se a declaraçones que nun tienen conteníu de maneira dala, nin mesmamente trivial.

Fhonte:

https://sciencefiles.org/2017/08/24/der-verrat-der-intellektuellen-schwulst-pratentioses-geschwatz/

Alma d’un collectivista

Audio:

“Siempre dixera esso precisamente. Claro, preciso & abiertamente. Nun ye culpa miya si nun fhuisti quien a ascuîtschalo. Podíes, claro que sí. Nun quexhisti. Lo que m’assegurára mas que la surdeira – a min. Dixi que andaba intentando mandar. Cumo tolos mîos predecessores spirituales. Pero sou mas sortudu que elhos. Heredei l fruîtu l sou puxu & serei l que vea l gran suenyo tornase real. Veo-lo wey arrodiando-me. Reconhoço-lo. Nun mi presta. Nun speraba que mi prestare. Gozo nun ye la miâ meta. Atoparei essa satisfacçon tanto cumo you sea quien a permittimi-lo. Mandarei…”

“Ye solo question d’atopa’ la palanca. Si deprehendes a domina’ l alma d’una sola persona, yes a apanya’l restu la humanidá. Ye l alma, Peter, l alma. Nin tralha nin spada nin fhouew nin armes. Ye polo que los Césares, los Atilas, los Napoleones fhueran fatos & nun duráran. A nós vaî vaganos. L alma, Peter, ye aquelho que nun se ye a gubernar. Ha frayase. Tyanta-y una pina, metti-yi los dedos dientro – & la xhente ye tuyo. Nun necessitarás tralha. Traheran-ti-la & pediran-ti tralhalos. Pon-lo a la inversa – & el sou propriu mechanismu fhairá-ti l trabayu. Usa-lo contra si mesmo. Quieres saber cumo se fhai? Mira a ver si da quando ti mintiera. Mira a ver si nun lo ascuîtscháras per anhos, pero nun quexhisti ascuîtschar, & la culpa ye tuya, non miya. Exsisten mũîtschos caminos. Ende un: Fhai a la xhente sentise pequenho. Fhai-lo sentise culpable. Mata la suâ aspiraçon & la suâ integridá. Ye dificil. El peyor d’ente vós outros anda a la gëta d’un ideal nel sou propriu camin intorniau. Mata la integridá por corrupçon interna. Usa-lo contra si mesmo. Impobina-lo scontra una meta destructiva de toda integridá. Predica altruismo. Di-yi a la xhente que deben vivir pa los outros. Di-yi a la xhente que l altruismo ye l ideal. Dala persona lo algamára & dala lo fhairá. Cada instinctu vivu glraya n contra. Pero nun captes cun tigo lo que algamasti? La xhente repara n que nun ye quien a algama’ lo que acceitára cumo virtú mas noblre- & dá sentimiento de culpa, de peccaho, de la suâ propria indignidá básica. Una vez que l ideal supremu anda fhuera l sou algame, la xhente renuncia eventualmente a tolos ideales, a toles aspiraçones, a tol sou valor personal. Siente-se forçaho a predica’ lo que nun ye a practicar. Pero uno ye a ser bono a mediu camin ou honraho approximadamente. Guarda’ la propria integridá ye una batalha dificil. Por que guarda’ lo que uno ya sabe ser corrupto? L alma abandona la suâ autoestima. Tienes-los ya. Obedeceran. Seran felizes por obedecer – por poder sfhoutase de si mesmo, la xhente siente-se incierto, siente-se impuro. Essa ye una maneira. Ende outra: Mata l xhuizio valores de la xhente. Mata l poder reconhoce’ la grandeza ou d’algamala. Los grandes homes nun son gubernables. Nós outros nun queremus gran home dalu. Nun niegës la concepçon de grandeza. Destruyi-la dende dientro. Lo grande ye lo raro, lo dificil, lo excepcional. Igua patrones de progressu abiertos a todos, mesmamente al mas inepto, & pararás l ímpetu al puxu que tola xhente, grande ou pequenho tien. Interrumpes todu incentivu al Ameyorar, a la excelencia, a la perfeiçon. (…)

Students in School Uniforms Standing in Formation

(…) Nun la intames abrasando tolos templos – la xhente acorará-se. Sanctifica la mediocridá  – & los templos seran abrasaus. Inda, ha hi outra maneira. Mata de risa. La risa ye una fherramienta de l alhegría humana. Apprehendi a usala cumo arma de destrucçon. transforma-la n disprezio. Ye simple. Di-yi a la xhente que ría de todo. Di-yi que una gracia ye una virtú illimitada. Nun deixes remanecer nada sacro na alma la xhente, & l alma nun será sagrada. Mata la reverencia & matasti l titan na persona. Nun se reverencia cun una risadina. La xhente obedecerá & nun acoutará lhendes pa la suâ obediencia – todo val-  nada ye abondo serio. Ende outra maneira: Ye per-importante. Nun deixes a la xhente ser feliz. La felicidá ye autónoma & autosuficiente. La xhente feliz nun tien tiempu nin ti ye util. Xhente feliz ye xhente lhibre. Intos, mata la suâ alhegría de vivir. Retira-y lo que y ye caro ou importante. Nunca y deixes tene’ lo que quier. Fhai-yi sentir que una mera ambiçon personal ye l mal. Lheva-lo a una circumstancia u dizir ‘you quiero’ ya nun ye un dreitschu natural, ma una admiraçon vergonhosa. N esto l altruismo ye de gran adiuda. Xhente infeliz vaî veniti. Vaî necessitate. Vaî venir pa consuelu, pa apoyu, pa scape. La naturaleza nun permitte lo vacuo. Vazia l alma la xhente – & el spacio ye tuyo pa completalo. Nun sei por que debes andar surprehendíu, Peter. Esto, esto ye lo mas vieyo de todo. Mira la historia. Mira qualquier gran systema d’éthica, d’Oriente. Nun predicaben todos el sacrificio de l allegría personal? So tolos ingëdeyos del parlloteu, nun tuvieran elhos un únicu leit-motiv: sacrificio, renuncia, abnegaçon? Nun fhuisti a pilha’l sou cantarin: “Renuncia, renuncia, renuncia, renuncia”? L atmósphera moral de wey. Tolo agradable, de cigarros a sexu a ambiçon por motivos de proveitschu, considera-se pervertido ou peccaminoso. Prueba solo que una cousa fhai a la xhente feliz – & ya lo tienes condemnaho. Ye ta u fhuimus a tyigar. Amarramus la felicidá a la culpa. & tenemus apañada a la humanidá pela cerviz. Lhança l tou herederu a una fhogëira de sacrificio – eitscha-te n riba una cama punctes- entra n desiertu por mortifica’ la carne – nun bailles – nun vaigas al cine l domingo- nun tentes de t’enriquecer – nun fumes, nun bebas. Ah! Todo na mesma riestra. La gran riestra.

Los babayos piensen que los tabus d’esti character son fatos. Daqué sobrante, vieyo. Pero siempre ha hi un propósito no fato. Nun te preoccupes n examinar una lhoucada: intruga-ti mal a penes que ye lo que algama. Todu systema d’éthica predicando l sacrificio tornou-se poder mundial & gubernou milhones de persones. Claro, has vistilu. Has dizir a la xhente que algamará un typu superior de felicidá al renunciar a tolo que y fhai feliz. Nun tienes falta ser per-claru. Usa grandes palhabres vagës. “Harmonía Universal” – “Spíritu Eternu” – “Propósito Divino” – “Nirvana” – “Paraisu” – “Supremacía Racial” – “La Dictadura l Proletariaho”. Corrupçon interna, Peter. Ye lo mas vieyo de todo. La farsa lheva rulando de magar sieglos & la xhente indagora cai. Ente tanto, la prueba será ansí de simple: ascuîtscha qualquier profeta & si lu sientes falar de sacrificio – scapa. Scapa mas rápido que de, que d’un andaçu. Podemus argumentar que, u ha hi sacrificio, ha hi daquien collecionando offertes de sacrificio. U ha hi servicio, ha hi daquien que anda siendo servíu. La xhente que fhala cun tigo de sacrificio, fhala de sclravos & amos. & pretende se’l amu. Pero si da quando ascuîtsches daquien diziti que debes ser feliz, que ye l tou dreitschu natural, que l tou Deber primeiru ye pa cun tigo mesmu- será daquien que nun anda tres la tuâ alma. Será daquien que nun tien nada que ganhar cun tigo. Pero deixarás que venga & glrayarás ta l spañíu de la tuâ cabeça vazia, berrando que ye un monstro egoísta. Por tanto, el volador tira seguru per mũîtschos, mũîtschos sieglos. Pero igual ende notasti daqué. Dixi: “Ye conforme a la razon.” Ves-lo? La xhente tien una arma contra ti. Razon. Intos debes tener certeza de xebrala de la xhente. Fraya-y los sofhitos per baxo. Pero anda cun cuenta. Nun la niegës da fheitscho. Nunca niegës nada da fheitscho, rescamplaríes. Nun digas que la razon ye maligna- Magar tenga xhente tyigaho ya tan lhuenye & cun un éxitu surprehendente. Di solo que la razon ye limitada. Que ha hi daqué per riba. Lo que? Tampouco tienes falta ser abondo claru. El campu ye infinitu. “Instinctu” – “Sentimiento” – “Revelaçon” – “Intuiçon divina” – “Materialismo dialéctico”. Si daquien te pilhou n daqué puncto crucial & daquien ti diz que la tuâ doctrina nun tien xacíu- ya stas preparau. Dizes-y que ha hi daqué per riba l xhuizio. que ende nun debe tentar de pensar, debe sentir. Debe tener infhoutu. Suspendi la razon & ganes el xhouew. Qualquiera cousa martschará cumo quexhieres siempre que tuvieres falta. Pilhasti-lo. Yes a gubernar xhente que piensa? Nun queremus xhente que piensa”.

Excerptu del capítulu XIV  “The Fountainhead”

Fhonte:

https://campus.aynrand.org/works/1943/01/01/the-soul-of-a-collectivist/page1http://pclib.github.io/safari/english/the-fountainhead/index_split_064.html

Frailes que fhalaben pidgin lùdicu

Frailes medievales fhalaben ente si una mixtura de lhatin & vernáculo. Yera una lhingua informal pa los que s’iniciaben.

Frailes eruditos europeos occidentales fhalaben nel sieglo XI da quando pante si, una singular amecedura de la fhala vernácula local (fhormes mas antigues d’irlandes, alto- alleman, & talvez tamien hollandes) & lhatin.

Mũîtscho nos lo indica. Lo principal – magar que indirecto – n evidencialo son les ‘glosses’, commentarios informales scriptos nes veires ou ente los renglones de textos theológicos exsistentes. Da quando tol tiempu, mũîtsches vezes na mesma phrase, diendo & viniendo ente lhatin & vernáculo. Casos d’estos conhocen-se n monasteirios angleses & allemanes.

Talvez los meyores exemplos son delhos vieyos manuscriptos irlandeses, cumo los commentarios in Félire Óengusso (Calendario Sacro Oengus), u Nike Stam, specialista n lhingues celtes, acabante obtene’l sou doctorau na Universidá d’Utrecht.

El textu anotau ye da parti’l sieglo IX, el commentario de riba ye de dous ou trés sieglos mas tarde. Stam: “El commentario forneç detalhes de los sanctos que se tracten ende. & la intençon yera probablemente explicar essi irlandes del sieglo nueve, por tener camudada ya considerable la lhingua irlandesa nos sieglos venientes”.

Nel commentario van irlandes & lhatin entemicidos. Ha hi, por casu, ayures “scarait feliciter” (elhos fhueran felizes dixebrando-se). La primeira palhabra ye irlandesa, la segunda lhatina. Outru exemplo mas lhargo appaeç ansí: “hoc die ad romam tasc bais maire pervenit“: ‘N essi díe, tyigou la noticia la muerte Maria Rome’ (lhatin n itálicu).

“Un fraile vaî mercar & fhai-lo n un tracamundio incomprehensible pal de fhuera d’angles & Lhatin”

Nike Stam piensa que se ye quien a ver a partir del textu que los frailes fhalaben les duês lhingues bien. “Ye bien probable que elhos tamien, da quando, ente si fhalaran irlandes & lhatin. Ha hi un textu ceho medieval que nun ye cumo pa lu destimar: un frae vaî al mercau & fai d’elho un barulhu incomprehensible”.

Enteteixer pente cada unu de dous idiomas differentes n una conversa ente xhente fhalando-les bien tyama-se code-switching. Na década los noventa fhoi ente linguistas n Hollanda thema d’investigaçon popular & real. Comprueba-se bien n Hollanda: Ascuîscha-se fhalar peles caleyes ou n tren: fhiyos de migrantes fhalando ente si un barulhu virtuosu d’Hollandes & outru idioma (cumo Berber ou Turco).

data18976609-6611b2

Irlandes & lhatin entemicidos nos commentarios al Félire Óengusso del sieglo nueve (Sancto Calendario Oengus). Diç: “hoc die ad romam tasc bais maire pervenit”: “n aquel díe tsigou la noticia la muerte María Rome” . Les pallabres tasc bais maire son irlandeses.
Photo Bibliotheca Bodleian, Oxford

Normalmente un phenómeno coloquial, nós pensamus. Sí que ansí cola tyigada la Rede de redes & los teléphonos cellulares, agora ye scripto (bien, mechanographía-se) & nacen variedaes u se dá n gran scala: applicativos, foros na Rede.

En Maroc.nl daquien scribe: “In Shaa Allah dat je met behulp van Allah Ta’ala in de waarheid je weg helemaal terug vindt, that the nights no longer frighten you and the days lighten up” (trés idiomas!) (“Ansí quiera Dîous que cun adiuda de Dîous & la verdá a la suâ maneira vuelvas a atopa’l camin, que les nueitsches ya nun t’assusten & los díes aclaren”). Un portal impobinau a la mocedá chino-hollandesa: “Er gaat niks boven tung fong leu seng fung mee” (“Seng tung ato fong leu ye lo mas”). Tamien s’incuentra commutaçon de códigu a maguyu ente hollandes patron & dialectu. GeenStijl por casu: “Ik stel voor dat we bijeen leggen voor een nieuwe tractor voor deze jongeman. Alleen welke kleur tractor hedde gij?” (“propongo cotizar in communya por un tractor nuevu pa esti muçu. Solo que de que color?”).

Los commentarios de los freiros irlandeses yeren probablemente tan informales, & igual s’engëdeyaben tanto, cumo estes reacçones nos foros de la Rede.

Nike Stam: “El barulhu fhai-se automático, en parte consciente & en parte inconsciente. Da quando se yos ve preferir dizir daqué n lhatin, pero mayormente paeç da fheitscho arbitraîrio. Ye daqué que tamien se cultiva dientro de tal collectivu. Da-yos el sou proprio spacio, la suâ propria identidá. Essos frailes posicionáran-se cun esto cumo una elite independiente fhuerte spiritual & intellectual”.

Ha hi tamien un guapu exemplo d’un commentario de textu hollandes, u los monxhos combinen ente si la suâ lhingua nativa cun lhatin. Coincidentemente – ou non casual del todo? – esti ye un commentario l primer textu n hollandes mas lhargu que tenemus: El Leidse Willeram, una adaptaçon del Cantar los Cantares n hollandes antiguo a medies del sieglo once. Ha hi un commentario que per-detalha & pol que s’explica cumo esti textu – a primeira vista un cantar de casorio cun tintes eróticos – ha ser cumo un discursu metaphóricu de la relaçon ente Dîous & el creyente. Una phrase týpica l commentario ye: “Wanda min sponsus is deus et homo ande her warth incarnatus ex virginali castitate”. Quier dizir: “Por se’l mîou home Dîous & home tornou-se n carne de la castidá immaculada”.

Fhonte:

https://www.nrc.nl/nieuws/2017/08/07/monniken-spraken-speelse-mengtaal-12416597-a1569155

Los lhibros d’audio & les promesses non caltenides del lhibru electrònicu.

Un interessante excerptu del “Giornale della libreria”, firmau por Alessandra Rotondo, Pon-mos de frente a una qüestion que de mano nos deixa plasmaus: “Anda morriendo l lhibru electrónicu?” Cumo ye esso, ho, ta a hieri pontificaba-se andar provocando l lhibru electrónicu la muerte cierta del lhibru tradicional, esto ye, del de papel, & ya andamus agora cun les oraçones e-fúnebres!” Passaus diez anhos de la tyigada del lhibru electrónicu al mercau, mũîtschos intrugen-se si l formato caltuvo les promesses fheitsches.

Les promesses (prophecíes ou minaçes) son per-consabides: l annichilaçon immediata, ou quajsi, del vieyu lhibru al que andabamus avezaus de magar ha ya quinientos anhos. Los datos polo contrario son allarmantes pal e-lhibru, cumo se sabe: in 2016 el lhibru electrónicu ãpunctou, segun l Associaçon los Editores Británicos, una baxa del 17 % (non n Italia, u polo contrario spoxigou). In Norteamérica, la baxada del e-lhibru fhoi mas que compensada pol spoxige del audiolhibru: 24% de los americanos declara-se “ascuîtschador” de lhibros, quajsi que un quintu per riba del 2015.

Son varios, intos, los elementos nos que se debía reflexionar. Glrayar al lhobu al lhobu cara a les nueves téchniques ye insensato siempre. Insensatos los excitaus hymnos a los progressistas & a les magnífiques suertes ; insensata la depression apocalýptica. La historia de la cultura vaî u mal a penes les mentes mas illuminades son a intuir: alcordaes-vos cumo s’intitulaba l ensayu d’Umberto Eco & Jean-Claude Carrière publicau por Bompiani n 2009? Tenía un títulu peremptoriu & quajsi ridículu: “nun vos sperar lhibrar de los lhibros”. Del resto fhoi l mesmu Eco, ha ya mas de cinqüenta anhos, a intrever un mundo diviso ente “apocalýpticos & integraus”: apocalýpticos los intelectuales antimodernos que identifiquen nes novedaes un catastróphicu & irrecuperable gotschaçu, integraus los optimistas que reciben a braços abiertos lo nuevo,  participen-vos-lo prestosa- & acríticamente. Opposiçon ye artificiosa pol sou mesmu inventor, si bien util pa discussion & análysis.

Lo que valía pa la cultura de massa d’aquelha val indagora wey pa les nueves techniques: demonio ou liberaçon democrática? El barruntu ye que si bien evoluyiéremus nel planu scientíficu, cuesta-nos liberanos de ciertes percepçones mentales. Nun ye verdá que exsistan solo los sinhalrdosos consolantes & los progressistas enthusiastas & insolentes. Exsisten víes medianes que coinciden, precisamente, cun una vision mas difuminada, mas cauta, crítica & disincantada.

& spueis exsisten tamien los progressistas cun sinhalrdá & los críticos insolentes. Aquelhos que igual agora que l e-lhibru anda n crisis glrayen: “Viva, ya lo dixera you!”. & Ye possible que intamen expressar graves duldes sobre l audiolhibru, sin pensar que ye l systema mas vieyu de transmission de litteratura.

Fhonte:

http://www.corriere.it/opinioni/17_agosto_08/audiolibro-promesse-non-mantenute-dell-book-4f6cc30e-7bae-11e7-8e8c-39c623892090.shtml?cmpid=tbd_4bb417f1CI

Dunja Hayali

Dunja Hayali ( 6. xhunhîo de 1974 n Datteln) ye una communicadora allemana, conductora de television.

Biographía

Procedencia, mocidá, formaçon

Dunja Hayali ye fhiya de iraquinos christianos de Mosul. La maî ye christiana caldea cathólica, sou paî ye christianu sirio-ortodoxu . Hayali yera mesmo cathólica & na suâ mocedá acólita, pero deixou la ecglresia. Los sos paysanos mudáran-se de Bagdá primeiro a Wien, cun intençon studiar medicina & farmacia . Nel momento de nacer Hayali lhevaba sou paî un consultorio particular in Datteln, u la maî lu adiudaba. L ermanu mayor de Hayali tamien ye médicu, la suâ ermana mayor trabayou cumo infirmeira & lhouew n un hospital. Na suâ mocedá practicou differentes sports. Xhogou al volley & al football, entreinou judo & ta los 15 anhos tennis  cumo sport competitivu.

Studiou de magar 1995 ta 1999, na Deutschen Sporthochschule Köln, in Köln , cun focu n “communicaçon & medias”. Al in par cun los studios completou práctiques in canales de TV & staçones de radio allemanes

Carreira d’informadora, visibilidá, compromissu político-social

Dunja Hayali (2013)

Lhouew de formase, trabayou cumo presentadora de sport de la radio Deutsche Welle (Colonia/Bonn), cumo trabayadora independente n Radio Köln, & cumo presentadora l programma noticies Journal de la Deutsche Welle TV in Berlin. Pa tras , Hayali moderou delhes emissiones de sport & noticies na emissora local de TV tv.nrw, que cessou de radiar mediau 2005.

N abril 2007, assumîu Hayali la moderaçon de heute-nachrichten de la ZDF (specialmente Wey– n Allemania & les ediçones del fin selmana), ansí cumo la copresentaçon del heute-journal, cabo l presentador principal Steffen Seibert. De magar outschoûbre 2007, moderou tamien el ZDF-Morgenmagazin, que presentou a partir outschoûbre 2010 cumo sucessora de Patricia Schäfer, cabo Wulf Schmiese ou Mitri Sirin nel final les emissiones de la tarde (7 a 9 PM) cumo principal presentadora. In 21 septiembre 2010, Hayali appaecîu por última vez cumo amphitryona no heute-journal.

Nos veranos de 2015 & 2016 stuvo Hayali nel puestu de Maybrit Illner cumo presentadora l programma de la ZDF,  ZDFdonnerstalk. Esti programma de discussion continuará cumo nuevu spacio sol títulu Dunja Hayali.

Tien moderados tamien eventos cumo l congressu d’altu nivel d’energíes renovables.

Dunja Hayali fhoi laureada col Goldenen Kamera 2016 na categoría de meyor informaçon. Nel sou discursu cun occasion de la ceremonia de premios el 6 mayo 2016, thematizou tamien a cerca l odio del que fhuera diana lhouew dalgun tiempu. Dixo que “n un pays u la lhibertá d’expression se tien cumo un gran bien, pueden & deben todos expressa’ les suês preoccupaçones & los sous temores, en sin mangalos directamente nel requeixu nazi. Pero, si expressaes comentarios racistas, intos vós soes unos malditos racistas”. Al da’l sou discursu, recibîu una ovaçon de pie na sala.

In febreiro 2016, condenou preventivamente l tribunal regional de Hamburgo un usuariu por commentarios abusivos d’odio n Facebook na tyana de Hayali. El tribunal declarou una multa de ta 250.000 euros si hôubiere violaçon.

Ye una defensora de la Associaçon  Gesicht Zeigen!  (insenya la cara!). Cumo ambaissadora sofhitou la iniciativa, Respekt! Kein Platz für Rassismus. (Respeitu! In sin sitiu pal racismo).

Vida privada

Hayali fhixzo público n 2008 que de magar 2007 andaba n una relaçon amorosa cun Mareike Arning, vocalista de la banda de Punk-Pop Uschi’s Orchester. El par dixebrou-se n 2011.

Premios

Dunja Hayali cun la presentadora Iris Berben nel Radio Regenbogen Award 2017 n Europapark, in Rust

  • 2016: Cámara d’ouro na categoría Meyor Informaçon.
  • 2016: Premio Robert-Geisendörfer : premio special del xhurau, por realizaçones publicistas ou artístiques exemplares.
  • 2016: Orden del mérito l Stau Nordrhein-Westfalen.
  • 2016: Premio Annemarie Renger del Arbeiter-Samariter-Bundes Deutschland 2017: Radio Regenbogen Award cumo Medienfrau 2016 (muyer de los medios 2016)

 

Publicaçones

Vínculos

Dunja Hayali n Twitter

Fhonte:

https://de.wikipedia.org/wiki/Dunja_Hayali

The New Yorker vs. el spectro descriptivista

29 mayo 2012 @ 1:57 pm Archivau por Ben Zimmer so adiectivos ignorancia de la linguística, lhingua & cultura , poppycock prescriptivista

Los lectores del The New Yorker igual anden recibiendo la impression de tene’ la revista daqué n contra un collectivu nefastu de persones conhocides cumo “descriptivistas”. Son un collectivu terrible, ta u sou a dizilo. Primeiro vieno Joan Acocella cun “The English Wars” na ediçon del 14 mayo (ver publicaçones de Mark Liberman, “Rules and ‘rules’,” “A half century of usage denialism“). & agora la vendetta continua n riestra cun la publicaçon de Ryan Bloom nel blog Page-Turner de la revista, “Inescapably, You’re Judged By Language“, que garante rescamplar a los descriptivistas fhoriones & el sou “secretin gotschu”.

La publicaçon de Bloom comiença abondo bien, ãpunctando cumo adaptamus la nuessa fhala al nuessu público, fhueren lectores del The New Yorker ou fhueren vezeiros d’un tschigre. Nel tschigre, intrugar “For whom are we rooting today?” en cuentes de “Who’re we rooting for?” diba ser bien inadequaho. “In summa, público differente, dialectu differente”, resume-lo elhi – magar dilo arreformular los sociolinguistas probablemente meyor cumo “público differente, differente tessitura“. Véi-lo, ha hi todu un campu de studio que anda smolreciendo-se examinando cumo ciertes variedaes de fhala se consideren adequades qua ciertes configuraçones sociales … pero ya ando you adelantrando de mas.

Bloom intos intruga:

Si “correcta” mal ye una qüestion de situaçon, intos lo que realmente debíamus andanos qüestionando ye por que nos fhai falta poder usa’ les duês versiones de la phrase. Por que nos fhai falta matanos por apprehende’ les rieglres del angles prescriptivo —les de la schuela primaria — si nun son el nuessu dialectu natural? Por mas revoltura que dea, la simple respuesta ye que nos fhai falta apprehender angles prescriptivo por se’ la maneira de podese communica’ la xhente nel Poder.

Agora, quien ye quien a argumentar contra tala “respuesta simple”? Adivinastis-lo, los descriptivistas:

Xhente que diz lo contrario, que diz que n toles situaçones hemus fhalar & scribir cumo nos prestare, ignoren la realidá actual. Esti collectivu, conhocíu cumo descriptivistas, ye a andar bregando por idees noblres, por couses cumo la nivelaçon del elitismo & el suavice de la classe social, pero anda dispreziando l precio real de tales idees, dispreziando a seres humanos de carne & wesso, a los que se yos niega un trabayu ou una educaçon, por mas erroneo que seya, al xhulgalos duro por cumo fhalen & scriben wey.

El virayueyu l descriptivismo ye fallaciosu, ansí cumo lo fhoi nel ensayu d’Acocella: Essa xhente “diz deber nós in toles situaçones haber de fhalar & scribir cumo nos prestare!”. Noticia d’última hora: de tolos linguistas descriptivos & lexicógraphos que conhocí & cun los que trabayei al passa’ los anhos, nun sou quien a poder pensar n un solo que diga lo que Bloom diz dizir elhos. Pero esta postura infamante attribuyida a descriptivistas spectrales deixa intos a Bloom revela’l sou “secretin gotschu”:

Quando yos tyega la hora de scribi’ los sous lhibros & artículos & de da’ los sous discursos sobre lo malo, elitista, racista, necio de força’ les “rieglres” a les masses, siempre lo fhaen n angles prescriptivo n sin faltes. Abelhogando-se per tras d’una mázcara de fines noblres, daqué obscenamente insincero anda occurriendo ende. Que facil y ye a daquien que ya fhai parte la élite linguística contay a outros que nun son lo que nun tienen falta ser. Ou, cumo Joan Acocella diz, los descriptivistas van “apanya’l Rolls. Vós vaes dir andando, ente tanto”.

Bloom termina cun daqué mas d’invectives contra “estos linguistas fhazéi-lo-como-vos-preste” que pretenden que la “utopía ye algamable, que tola xhente ye revolucionario, que l anarchía linguística vos libertará.” You mi prestaba atopar un d’essos anarcholinguistas, por paecemi per-divertidos, pero tengo la lherça que elhos mal viven na phantasía de xhente cumo Bloom & Acocella, continuando l camin del sou antepassau illustre qua virayueyu descriptivista, David Foster Wallace.

Linguistas & lexicógraphos reales que respuenden al selho “descriptivista” tienden a andar cun abondes preoccupaçones cun precisamente los assumptos que Bloom affirma andar por elhos disattendidos. Ye una fhorma linguística specífica considerada erronea? Si ansí fhuere, qualo ye lo que motiva l attribuçon del yerru? Será la persona que fhixzo l yerru n qüestion a reconhocelu cumo yerru ou attribuyilu a la lhingua ou al lhapiceru que svariou? Ou ye una variante linguística dispreziada por associase cun un dialectu stigmatizau, & ein casu affirmativu, cumo la relaçon ente les fhormes “patron” & “non patron” revela dynámiques sociales mas amplies passando l tiempu? &, acabando, quala variedá d’un idioma ye la appropiada & in quales situaçones sociales, & cumo saleen los oradores & scriptores ente les alteraçones de variedaes nes suês vides diaries?

N outres palhabres, l usu situacionista nel mundo real de fhormes de fhala nun ye daqué que se ridiculize por descriptivistas, por ser essa variabilidá una parte essencial al describi’ la fhala. Ignora-lo ye da veres a tornate non descriptivista. Weyai qualquier gran diccionario de lhingua anglesa fheitscho nel últimu mediu sieglo ou ansí (mesmamente l criticadíssimo Webster’s Third New International). Magar ser trabayu de lexicógraphos descriptivistas, los diccionarios, invariablemente, fornecen marques d’usu, & mesmamente notes d’usu indagora mas extenses, cun la intençon de fhacey saber al lector quando una determinada fhorma ye d’ordinario reconhocida cumo non-patron, téchnica, colloquial, offensiva, ou lo que se prefiriere.

Reconhocer esti fheitschu enforma simple sobre descriptivistas sería inconveniente, por nun poder intos Acocella & Bloom acusalos de proponer hypocriticamente una approximaçon “todo val” in quanto elhos mesmos observen convençones linguístiques patron. Cumo Jan Freeman scribîu n retruque al ensayu d’Acocella, “ye possible deprehender angles patron scripto & tamien qüestiona’ les zunes & velees de los nazis de la grammática”. Nun exsiste un “secretin gotschu” ende, por nun haber conflictu ente la mission de la fhala descriptiva, cumo esta ye realmente usada (in cuentes de cumo los prescriptivistas quieren que lo seya) & adheriendo-se a los patrones stylísticos que conformen un códigu cumo appropriau n una situaçon. Los descriptivistas viven tamien nel mundo real. Talvez el personal de The New Yorker deba salir & conhocer un ou dos d’elhos.

[Actualizaçon: La postrer ediçon de The New Yorker (4 & 11 xhunhîo) incluye trés cartes de respuesta al ensayu d’Acocella. Un correspondiente procura defender a HW Fowler contra les acusaçones de tradicionalismo. Outru subscribe la schuela del mal-in-peyor del prescriptivismo, protestando contra horrores tales cumo “exact same” & “Did you finish your homework yet?” Felizmente, la charta restante ye de Steven Pinker, contestando la lectura decontroladamente fhuera tiestu del sou ensayu introductoriu del usu l American Heritage Dictionary. & you intiendo que Pinker habrá dizir daqué mas n esti assumptu n un futuro próximo n un scriptu pa Slate.]

[Actualizaçon, 5/30: Neal Goldfarb arressalta que Bloom axhunctára una actualizaçon a la suâ publicaçon, mentada nel blog WSJ Ideas Market Blog & ayures, pero que l actualizaçon disappaecîu mysteriosamente. Google nun paeç fornecer un caché accessible de la tyana, pero la indexaçon de Google sí que me deixou arrexhuncta’l textu l actualizaçon:

Actualizaçon: L aquel d’esta publicaçon nun ye discharta’ la linguística moderna inteira da fheitscho nin crear un argumento de “ou esto/ ou l outro. La brevedá de la publicaçon mal a penes deixa sitiu pa un recau simplificau: Si bien una persona debería ser quien a utilizar dialectos naturales (ou modalidaes), ha hi tamien razones práctiques pa apprehender “rieglres de classe elemental” & saber quando les applicar. Les duês idees son importantes, non incorrectes. Esti ye un argumento que concasa perfeitamente cun postulados descriptivos. Ditscho esto, ha hi ciertamente una differencia ente los obiectivos scholásticos de la disciplina mayor de la linguística descriptiva — un campu complicau per-valiosu da increyible— & la repunancia exhibida n ciertos ensayos tradicionales que promueven valores descriptivos extremos & al in par demonizando les normes prescriptives”. ”Ha ser nidio que l términudescriptivucumo utilizau indenante, refier-se a esti cabeiru gruppo.

…..

Fhonte:

http://languagelog.ldc.upenn.edu/nll/?p=3985

Haplogruppo I-M253

L haplogruppo I-M253, conhoç-se-lu tamien cumo I1, ye un haplogruppo l chromosoma Y. Los marcadores gënéticos confirmantes cumo identificantes de I-M253 son los SNPs M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L 125/S65, L157.1, L186, e L187. Ye l principal ramal l haplogruppo I-M170 (I*).

L haplogruppo cute l sou picu freqüencial in Suecia (52% de los homes in Condau de Västra Götaland) & de Finlandia occidental (trespassa l 50% na provincia de Satakunta). In términos de medies nacionales, I-M253 atopa-se n 35-38% de los homes suecos, 32,8% de los daneses, cammin de 31,5% de los norvegos & cerca de 28% de los fineses de sexu masculin.

L haplogruppo I-M253 ye l principal ramal l haplogruppo I* (I-M170), presente n Europa de magar tiempos antiguos. El principal ramal de I* ye l I-M438, tamien conhocíu cumo I2.

Lhouew d’arreclassifica-se 2008, al haplogruppo conhocía-se-lu cumo I1a, un nome que ya se y attribuyera a un ramal primariu, l haplogruppo I-DF29. Los outros ramales principales de I1 (M253) son I1b (S249/Z131) & I1c (Y18119/Z17925).

Indiç

Procedencia

Segun un studio que se publicou n 2010, el I-M253 formou-se ha ente 3,170 & 5,000 anhos, nel periodu Chalcolíthicu n Europa. Un nuevu studio, in 2015, estimaba la procedencia de 3,470 a 5,070 anhos ha, ou ente ha 3,180 & 3,760 anhos, gastando duês téchniques differentes. Paeç spardese inicialmente del territorio que ye wey Dinamarca.

Un studio de 2014, n Hungría, revelou restos de nueve specímenes de la Cultura la Cerámica Bandes, un d’ente elhos lhevando l SNP M253 definitoriu l haplogruppo I1. Piensa-se star esta cultura presente d’ente 6.500 a 7.500 anhos ha.

Structura

I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L 125/S65, L157.1, L186, e L187) ou I1

  • I-DF29 (DF29/S438); I1a

    • I-CTS6364 (CTS6364/Z2336); I1a1

      • I-M227; I1a1a

      • I-L22 (L22/S142); I1a1b

        • I-P109; I1a1b1

        • I-L205 (L205.1/L939.1/S239.1); I1a1b2

        • I-Z74; I1a1b3

        • I-L300 (L300/S241); I1a1b4

          • I-L287

            • I-L258 (L258/S335)

          • I-L813

    • I-Z58 (S244/Z58); I1a2

      • I-Z59 (S246/Z59); I1a2a

        • I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1

          • I-Z140 (Z140, Z141)

            • I-L338

            • I-F2642 (F2642)

          • I-Z73

            • I-L1302

          • I-L573

          • I-L803

        • I-Z382; I1a2a2

      • I-Z138 (S296/Z138, Z139); I1a2b

        • I-Z2541

    • I-Z63 (S243/Z63); I1a3

      • I-BY151; I1a3a

        • I-L849.2; I1a3a1

        • I-BY351; I1a3a2

            • I-CTS10345

              • I-Y10994

            • I-Y7075

        • I-S2078

          • I-S2077

            • I-Y2245 (Y2245/PR683)

              • I-L1237

                • I-FGC9550

              • I-S10360

                • I-S15301

              • I-Y7234

        • I-BY62 (BY62); I1a3a3

  • I-Z131 (Z131/S249); I1b

    • I-CTS6397; I1b1

  • I-Z17943 (Y18119/Z17925, S2304/Z17937); I1c

Distribuçon territorial

I-M253 atopa-se na so mayor densidá al norte d’Europa & d’outros paises que suffrieran intensa migraçon d’Europa l norte, bien in Periodu de Migraçon, bien in periodu vikingu ou bien in tiempos modernos. Atopa-se n tolos sitios que invadierun los vieyos pueblos germánicos & vikingos.

Na dómina moderna, poblaçones significatives del I-M253 tamien prendieran raizes nes naçones d’immigrantes & excolonies europees, tales como los USA, Australia & el Canadá.

poblaçon

tamanyu patron I (total) I1 (I-M253) I1a1a (I-M227) fhonte
Austria 43 9.3 2.3 0.0 Underhill et al. 2007
Bielo-Russia: Vitebsk 100 15 1.0 0.0 Underhill et al. 2007
Bielo-Russia: Brest 97 20.6 1.0 0.0 Underhill et al. 2007
Bosnia 100 42 2.0 0.0 Rootsi et al. 2004
Bulgaria 808 26.6 4.3 0.0 Karachanak et al. 2013
República Checa 47 31.9 8.5 0.0 Underhill et al. 2007
República Checa 53 17.0 1.9 0.0 Rootsi et al. 2004
Dinamarca 122 39.3 32.8 0.0 Underhill et al. 2007
Anglaterra 104 19.2 15.4 0.0 Underhill et al. 2007
Estonia 210 18.6 14.8 0.5 Rootsi et al. 2004
Estonia 118 11.9 Lappalainen et al. 2008
Finlandia (nacional) 28.0 Lappalainen et al. 2006
Finlandia: Oeste 230 40 Lappalainen et al. 2008
Finlandia: Este 306 19 Lappalainen et al. 2008
Finlandia : Satakunta 50+ Lappalainen et al. 20089
Francia 58 17.2 8.6 1.7 Underhill et al. 2007
Francia 12 16.7 16.7 0.0 Cann et al. 2002
Francia (Baxa-Normandía) 42 21.4 11.9 0.0 Rootsi et al. 2004
Allemania 125 24 15.2 0.0 Underhill et al. 2007
Grecia 171 15.8 2.3 0.0 Underhill et al. 2007
Hungría 113 25.7 13.3 0.0 Rootsi et al. 2004
Irlandia 100 11 6.0 0.0 Underhill et al. 2007
Kazan Tártaros 53 13.2 11.3 0.0 Trofimova 2015
Letonia 113 3.5 Lappalainen et al. 2008
Lituania 164 4.9 Lappalainen et al. 2008
Paises Baxos 93 20.4 14 0.0 Underhill et al. 2007
Norvegia 2826 31.5 Eupedia 2017
Russia (nacional) 16 25 12.5 0.0 Cann et al. 2002
Russia
Pskov
130 16.9 5.4 0.0 Underhill et al. 2007
Russia Kostroma 53 26.4 11.3 0.0 Underhill et al. 2007
Russia Smolensk 103 12.6 1.9 0.0 Underhill et al. 2007
Russia Voronez 96 19.8 3.1 0.0 Underhill et al. 2007
Russia Arkhangelsk 145 15.8 7.6 0.0 Underhill et al. 2007
Russia Cossacos 89 24.7 4.5 0.0 Underhill et al. 2007
Russia Carelios 140 10 8.6 0.0 Underhill et al. 2007
Russia Carelios 132 15.2 Lappalainen et al. 2008
Russia
Vepsos
39 5.1 2.6 0.0 Underhill et al. 2007
Slovaquia 70 14.3 4.3 0.0 Rootsi et al. 2004
Slovenia 95 26.3 7.4 0.0 Underhill et al. 2007
Suecia (nacional) 160 35.6 Lappalainen et al. 2008
Suecia (nacional) 38.0 Lappalainen et al. 2009
Suecia: Västra Götland 52 Lappalainen et al. 2009
Suiça 144 7.6 5.6 0.0 Rootsi et al. 2004
Turquía 523 5.4 1.1 0.0 Underhill et al. 2007
Ukrania Lvov 101 23.8 4.9 0.0 Underhill et al. 2007
Ukrania Ivanovo-Frankov 56 21.4 1.8 0.0 Underhill et al. 2007
Ukrania Hmelnitz 176 26.2 6.1 0.0 Underhill et al. 2007
Ukrania Tcherkássi 114 28.1 4.3 0.0 Underhill et al. 2007
Ukrania Belgorod 56 26.8 5.3 0.0

Underhill et al. 2007

Gran Bretanya

Mappa amosando la distribuçon de chromosomas Y n una secçon transversal d’Anglaterra & Pais de Gales, del trabayu “Chromosoma Y: evidencia de migraçon massiva d’anglo-saxones“. los auctores attribuyen les differencies in freqüencies del haplogruppo I a la migraçon anglo-saxona n massa pa Anglaterra, magar nun ser ansí n casu l Pays de Gales.

In 2002 asoleyou-se un artículu scriptu por Michael E. Weale & collegas presentando evidencia gënética de differencies ente les poblaçones anglesa & galesa, incluyendo un nivel porcentual perciptiblemente mas altu d’haplogruppo I-ADN n Anglaterra que n Pais de Gales. Vîu-se esto intos como una evidencia convincente d’invasion anglo-saxona massiva del oriente de Gran Bretanya a partir del norte d’Allemania & Dinamarca, contra l Periodu de Migraçon. Los auctores assumen fundase les poblaçones cun fhuertes proporçones d’haplogruppo I n Allemania l norte ou nel sur de Scandinavia, sobre maneira n Dinamarca, & migra’ los sos antepassaus pel Mar del Norte cabo les migraçones anglo-saxones & vikinges daneses. La principal revindicaçon de los investigadores fhoi

ser necessaria d’aquelha un eventu d’inmigraçon anglo-saxona affectando al 50-100% del fundu gënéticu de los homes d’Anglaterra central. Observamus, ente tanto, nun mos deixar differencia’ los nuessos datos un eventu cincielhamente addicionau al fundu hereditariu autochthone de los homes d’Anglaterra central, d’outru u los homes autochthones fhueran xebraus ayures ou onde los varones nativos fhueran reduzidos en númeru … Esti studio amuesa que la raya galesa fhoi mas una barreira gënética pal chromosoma Y & pal fluxu gënes anglo-saxon que l mesmu Mar del Norte … Estos resultaus indiquen ser una fronteira política mas importante que una geophýsica n una structuraçon gënética de la poblaçon.

Distribuçon los haplogruppos del chromosoma Y de Capelli et al. (2003). L haplogruppo I anda presente n toles populaçones, cun les freqüencies mas altes n oriente & baxes n occidente. Paeç nun haber una discontinuidá na lhende cumo apercibido por Weale et al. (2002)

In 2003, un artículu asoleyau por Christian Capelli & collegas sofhitou, magar que modificades, les conclusiones de Weale & collegas. Essi trabayu, que presentou specímenes de Gran Bretanya & d’Irlanda n quadrielha, atopou una minor differencia ente amuestres galeses & angleses, cun una diminuçon gradual na freqüencia del haplogruppo I diendo scontra occidente nel sur de Gran Bretanya. Los resultaus indiquen a los auctores tener influyido a sgaya los invasores vikingos norvegos na parte norte les Islles Britániques, magar tener toles amuestres angleses & scoceses de Gran Bretanya influencia allemana &/o danesa.

Miembros proeminentes del I-M253

Alexander Hamilton, por stirpe & prueba gënética de los sous descendientes (figurando-se cumo cierta la paternidá que y correspuende pola suâ stirpe), mangou-se-lu dientro l haplogruppo Y-ADN I-M253.

Birger Jarl, ‘Duque de Suecia” de la Casa los Godos de Bjalbo, fundador de Stocolmo, cun los sous restos inhumaus n una ecglresia atopaus in 2002, resultou ser I-M253.

Occupantes del Mayflower William Brewster, Edward Winslow & George Soule per pruebes de ADN

Marcadores

ADN: modello: cadena 1 diffier de la cadena 2 n un únicu par de base local (un C >> T del polymorphismu).

Les que vienen son les specificaçones téchniques de les mutaçones de los SNP & STR conhocidos del haplogruppo I-M253.

Nome: M253

Typu: SNP
Fhonte: M (Peter Underhill de la Universidá de Stanford)
Posiçon: ChrY:13532101..13532101 (+ cadena)
Posiçon: (pares de base): 283
Tamañu total (pares de base): 400
Extension: 1
ISOGG HG: I1
Iniciador molecular F (speyo 5’→ 3′): GCAACAATGAGGGTTTTTTTG
Iniciador molecular R (complementar 5’→ 3′): CAGCTCCACCTCTATGCAGTTT
YCC HG: I1
Alteraçon nucleotideos allelos (mutaçon): C por T

Nome: M307

Typu: SNP
Fhonte: M (Peter Underhill)
Posiçon: ChrY:21160339..21160339 (+ cadena)
Extension: 1
ISOGG HG: I1
Iniciador molecular F: TTATTGGCATTTCAGGAAGTG
Iniciador molecular R: GGGTGAGGCAGGAAAATAGC
YCC HG: I1
Alteraçon nucleotideos allelos (mutaçon): G por A

Nome: P30

Typu: SNP
Fhonte: PS (Michael Hammer , de la Universidá d’Arizona & James F. Wilson, de la Universidá d’Edinburgo)
Posiçon: ChrY:13006761..13006761 (+ cadena)
Extension: 1
ISOGG HG: I1
Iniciador molecular F: GGTGGGCTGTTTGAAAAAGA
Iniciador molecular R: AGCCAAATACCAGTCGTCAC
YCC HG: I1
Alteraçon nucleotideos allelos (mutaçon): G por A
Regio: ARSDP

Nome: P40

Typu: SNP
Fhonte: PS (Michael Hammer & James F. Wilson)
Posiçon: ChrY:12994402..12994402 (+ cadena)
Extension: 1
ISOGG HG: I1
Iniciador molecular: GGAGAAAAGGTGAGAAACC
Iniciador molecular R: GGACAAGGGGCAGATT
YCC HG: I1
Alteraçon nucleotideos allelos (mutaçon): C por T
Regio: ARSDP

Bancos de datos haplogruppo I

Rolf Peter Sieferle

Vida & Obra

Acabante studiar historia, sciencia política & studios sociales nes universidaes de Heidelberg & Constança (Allemania), Sieferle fhoi promovíu n 1977 doutor in philosophía na facultá de la Universidá de Constança cun una thesis sobre la theoría marxista.

In 1980, axhunctou-se a la communya de trabayu sobre l ambiente, la sociedá & la energía na Universität-Gesamthochschule Essen. De 1980 a 1984, andou ende implicau nel proyectu de pesquisa de Klaus Michael Meyer-Abich & Bertram Schefold  Die Sozialverträglichkeit verschiedener Energiesysteme in der industriegesellschaftlichen Entwicklung (El tschoque social de los differentes systemas d’energía nel disinvolvimiento industrial de la sociedá). La suâ publicaçon de 1982 Der unterirdische Wald. Energiekrise und industrielle Revolution (El viescu subterraneu. Crisis energética & revoluçon industrial), una publicaçon de la Federaçon de Scientíficos Allemanes, ye un patron de trabayu pa la transiçon de carburante de la madeira al carbon & la industrializaçon resultante. Quasi venti anhos mas tarde, appaecîu la traducçon anglesa, per riba revisada, na publicaçon specializada n qüestiones ambientales, White Horse Press. Contextual a un proyectu pesquisa de la década de 1980, presentou tamien una vision completa de los fundadores l ambientalismo n Allemania Fortschrittsfeinde? Opposition gegen Technik und Industrie von der Romantik bis zur Gegenwart (Inimigos del progressu? Opposiçon a la téchnica & a la industria, del romanticismo ta l presente), lhouew Energetische Weltgeschichte (Historia mundial energética) de Frank Uekötter. In 1984 algamou l títulu d’aggregau de lhibre docencia na Universidá de Constança, nel campu la historia moderna.

De 1988 a 1993, fhoi beneficiariu d’una beca l Programma Heisenberg del Deutsche Forschungsgemeinschaft (Conceyo d’Investigaçon Alleman). In 1989, recibîu una Privatdozentur na Universidá de Mannheim (n Allemania), & in 1991, fhoi professor adiunctu ende. Fhoi cathedráticu convidau n varies cáthedres in Zurich nel Instituto Federal de Téchnica de Zurich (ETH) & in Viena. In 1995, assumîu la direcçon del históricu focu de promoçon de la fundaçon basada n Stutgartt Breuninger Stiftung.

In 1995, Sieferle publicou “cinco rascunyos biográphicos”, de Paul Lensch, Werner Sombart, Oswald Spengler, Ernst Jünger & Hans Freyer , attribuyendo-los a la “Revoluçon Conservadora”. El sou trabayu fhoi d’aquelha fuertemente criticau por paeceres professionales (”German History, Politische Vierteljahresschrift”). Claudius R. Köster, por casu, censurou les suês representaçones cumo de “rascunyades” qua méthodu,  theoría & conteníu. Reconhocîu una “intençon político-provocadora” del, par elhi, auctor atyigau.  Pa Armin Pfahl-Traughber tracta-se de “ensayística” tendenciosa, pero cun contribuçones perspicazes. Nel últimu análysis seran problemáticos la selecçon de rascunyos & la “representaçon acrítica”, specialmente sol punctu de vista demócrata-theóricu. A communya cun Dirk Kretschmer & Siegfried Jäger del Duisburger Institut für Sprach- und Sozialforschung (Instituto de linguística & investigaçon social de Duisburg) el “Discípulu de Nolte” na suâ obra, tentou de “borra’ la sombra nazi que pesa n riba la estimativa de los auctores prefascistas”. Pa Volker Weiß tracta-se d’una “colecçon laudatoria de textos d’auctores del nacionalismo de Weimar”.

Na década de 1990 defendîu nel contextu d’una communya de pesquisa del Institut für Interdisziplinäre Forschung und Fortbildung, (”Instituto pa la investigaçon inter-disciplinar & la formaçon”) de Viena “una quantificaçon comprehensiva de los fluxos sociales de materiales & d’energía” (MEFA-Ansatz) (= accometida MEFA).

De 2000 a 2004 fhoi professor convidau permanente na Universidá de St. Gallen (Suiça) u se torna, in 2005, professor d’historia universal. Sieferle fhoi n esta campanya coeditor de la serie Umwelthistorische Forschungen (Pesquises históriques ambientales)” (Böhlau Verlag). In 2010, presentou unu de los trés peritos externos pal relatorio de peritaçon principal Welt im Wandel: Gesellschaftsvertrag für eine Große Transformation (Mundo n transiçon: Contractu social por una gran transformaçon) del Wissenschaftlichen Beirats der Bundesregierung Globale Umweltveränderungen (Conceyo Consultivo Alleman sobre cambios globales ambientales). 2012 fhoi l anhu l retiru. El trabayu de Sieferle centrou-se na structura & na historia de les idees la industrializaçon, ansí cumo de la historia ambiental & la historia universal.

Gustav Seibt, que tamien scribiera un obituario, considerou Sieferle como “un interessante stylista” cun una “fhuerte ousadía na formulaçon narrativa & theórica”. La suâ última fase creativa será charaterizada, mentanto, por un “spanyíu tracamundiau & primitivismo”, polo que la suâ “capacidá de discernimiento” tenría dissapaecido. Seibt attestou n Sieferle un “brutal cynismu”. Jan Grossarth rinde-y tributo nel Frankfurter Allgemeine Zeitung cumo “poéticu spíritu lhibre & gran historiador económicu”, & arrecalca a la vegada criticamente, ente tanto, tener Sieferle scripto lhouew d’una “revuelta a la dreitscha” in 2014  “lhibros gafientos de direitscha radical”.

Sieferle yera casau & vivía n Heidelberg, u se suicidou n 2016.

https://de.wikipedia.org/wiki/Rolf_Peter_Sieferle

Probabilidà bayesiana

El conceitu conhocíu cumo probabilidá bayesiana (ang. bayesianism) del mathemáticu angles Thomas Bayes, interpreta la probabilidá cumo grau de convicçon personal (angles degree of belief ). Ansí, differencia-se de la percepçon de probabilidá obiectivista, cumo del conceitu de probabilidá frequencista que interpreta la probabilidá como frequencia relativa.

El conceitu de probabilidá bayesianu nun debe ser tracamundiau cul theorema de Bayes, que tamien tien innúmeres applicaçones in statístiques .

Conteníu

1 Disinvolvimiento l conceitu probabilidá bayesianu
2 Formalizaçon l conceitu  probabilidá
3 Significau prácticu nes statístiques

El disinvolvimiento l conceitu probabilidá bayesianu

El conceitu probabilidá bayesianu ye utilizau da vezo cul fin de medi’ la credibilidá d’una declaraçon cun base nos nuevos discobrimientos. Pierre-Simon Laplace (1812) discobrîu esta explicaçon mas tarde, independiente de Bayes, & usou-la n problemas de mechánica astral, stadístiques médiques &, a communya cun daqué informaçones, mesmo n casos a resolver pola xhurisprudencia.

Por poner un casu, Laplace calculou la massa Saturno cun les observaçones astronómiques disponibles de la suâ órbita. Explicou los resultaus, cabo indicios de la suâ incerteza: “Apuesto 11.000 a 1 que l yerru n esti resultau nun ye mayor que 1/100 del sou valor.” (Laplace tenría ganhada l apuesta, por tener que se’l resultau 150 anhos mas tarde, debido a nuevos datos, mal retocau a penes un 0,37%.)

La interpretaçon bayesiana de la probabilidá fhoi inicialmente disinvuelta al intamu l sieglo XX, specialmente n Anglaterra. Principales cabeces pensantes fuerun al in par Harold Jeffreys (1891-1989) & Frank Plumpton Ramsey (1903-1930). El cabeiru disinvolvîu una approximaçon que, por causa de la suâ muerte prematura, nun podría continuar, ente tanto, fhoi tomada independentemente n Italia por Bruno de Finetti (1906-1985). La idea básica ye “estimatives razonables” (Ingl. rational belief) como una universalizaçon de los compromissos tácticos a considerar: dará-se una quantidá de “informaçon / acçon / datos” & buscará-se una respuesta a la pregunta relativa de ta u s’apuesta pola solidez de la evaluaçon o qué opportunidá tenrá. (El fundu ye que solo s’apuesta mũîtscho denheiro al andar unu seguru de la suâ propria evaluaçon. Esta idea tuvo un gran impactu sobre la Theoría l Xhuew). Una riestra de pamphletos n contra los méthodos statísticos (frequencistas) derivou d’esta idea básica, debatida de magar la década l 1950, ente bayesianistas & frequencistas.

Formalizaçon del conceitu probabilidá

Stamus preparaus pa la interpretaçon de la probabilidá cumo una “evaluaçon de la seguridá personal de los fheitschos & les circumstancies” (vea-se a riba), intos surde la pregunta, quales propriedaes racionales ha tener essa possibilidá pa nun ser contradictoria. Fornecierun-se contribuçones significatives de respuesta de parte de Richard Throkod Cox (1946).

Requier la validez de los principios que vienen:

Transitividá: Si la probabilidá de A fhuere mayor que la probabilidá de B, & B tien una mayor probabilidá que la probabilidá de C, intos la probabilidá de A ha de ser tamien mayor que la probabilidá de C. Sin esta propriedá nun sería possible expressar probabilidaes in cifres reales, por sta’ les cifres reales curiosades tamien de fhorma transitiva. Pa de tras, exsisten paradoxes cumo la que vien: un home que nun intiende la transitividá de la probabilidá, apostou n una carreira al cabalhu A. Pero agora piensa, sicasí, se’l cabalhu B meyor, & camuda l apuesta. Tien que pagar un pouco mas, pero nun y importa, por tener agora una apuesta meyor. Intos paeç-y se’l cabalhu C melhor que l B. Torna a cambia’ la apuesta & tien que pagar un pouco mas. Agora, avulta-y, in tanto,  el cabalhu A ser meyor que l C. Vuelve pagar un pouco mas. Avulta-y siempre algamar una meyor apuesta, pero agora todo ye cumo inantes, solo ye mas probe.

Negaçon: Quando tenemus una expectativa de verdá dalgo, intos, implicitamente, tamien tenemus una expectativa de la suâ falta de verdá.

Condiçone: Quando se tien una expectativa de verdá del H, & tamien una expectativa de verdá de D, in casu de H ser cierto, intos implicitamente, tamien se tien una expectativa de verdá simultanea de H & D.

Consistencia (sensatez): Si exsisten varios méthodos pa usar ciertes informaçones,  intos la conclusion ha ser siempre la mesma.

Valores de probabilidá

D’esto resulta deber applicase les rieglres de valores de la probabilidá de W (H):

bayesianism

Esso significa que:

H ou D: La hypóthesis ye verdadeira (ou produz-se l eventu H ) ou l eventu D tien-se produzido.
W (H): La probabilidá de que la hypóthesis H sea verdadeira, ou que l eventu H se produza.
! H: non H: hypóthesis H nun ye verdá, ou H l eventu nun se produz.
H, D H  &  D son verdadeiros ou produzen-se, ou unu ye verdadeiru & produz-se l outru.
W (D | H): La probabilidá de la hypóthesis D ser verdadeira, ou que l eventu D se produza n casu ser H verdá ou se produza.

De les rieglres d’a riba de valores de probabilidá son a derivase outres.

Significaçon práctica n statística

Pa resolver talos problemas, in tanto, cumo parte la interpretaçon frequencista, la incerteza ye descrita per una variable specialmente inventada de tamanyu aleatoriu. La theoría la probabilidá bayesiana nun tien falta pa realizalo d’una variable auxiliar. In cuentes d’esso, introduz-se l conceitu de probabilidá a priori que reconhoç el conhocimiento previo & los presuppuestos básicos del observador n una distribuçon de probabilidá. Representantes del aveiramiento bayesiano ven cumo de gran superioridá, los conhocimientos previos & supposiçones apriorístiques explicitamente expresses nel modello.

Fhonte:

https://de.wikipedia.org/wiki/Bayesscher_Wahrscheinlichkeitsbegriff

Galliano

Galliano fhoi una banda d’Acid Jazz de Londres activa ente 1988 & 1997. La banda fhoi la primeira roblra l selho de grabaçon Acid Jazz d’Eddie Piller & Gilles Peterson. Los miembros primeiros fhuerun Rob Gallagher (vocalista – acreditau cumo Roberto Galliano), Constantine Weir (voz), Michael Snaith (Controlador d’Ambiente) & Crispin Robinson (percussion). Outros miembros importantes incluyíen Valerie Etienne, que participou na grabaçon de tolos albuns, cabo outros músicos cumo Mick Talbot al teclau, Crispin Taylor na batería, Ernie McKone al baxu, gitarra Mark Vandergucht & Steve Ameedee, conhocíu tamien cumo Tio Big Man (dança).

El primer single la banda, una reformulaçon del “Freddie’s Dead” de Curtis Mayfield tyamau “Frederick Lies Still” foi sacau n xhunio 1988. Fhoi tamien la primer ediçon del selhu Acid Jazz.

Galliano algamou lo cimeiro l sou éxitu n 1994 cun The Plot Thickens, tyigando al númeru siepte de la lhista d’albuns UK.

Galliano proporcionou l corte usau na seqüencia l títulu la película de Kevin Reynolds en 1997 One Eight Seven, protagonizada por Samuel L. Jackson.
El cantar “Slack Hands” appaeç nel sou album de 1996: 4

In 1997, Gallagher sfhixzo Galliano & continuou cun outros proyectos musicales, Two Banks of Four & Earl Zinger (cantante de reggae).

Discographía

Albuns

In Pursuit of the 13th Note – 1991 – Talkin’ Loud
A Joyful Noise Unto The Creator – 1992 – Talkin’ Loud UK #28
The Plot Thickens – 1994 – Talkin’ Loud UK #7
4 1996 – Mercury Records

Compilaçon albuns

What Colour Our Flag – 1994 – Talkin’ Loud
Thicker Plot (remixes 93-94) – 1994 – Talkin’ Loud
Live at Liquid Rooms (Tokyo) – 1997 – Talkin’ Loud (Mercury Records)

Mix Galliano

Fhonte:

https://www.discogs.com/artist/1561-Galliano

Experimentamus solo una prosperidà apparente – la pròxima ruina anda ya n cammin.

Audio:

La política monetaria flrouxa de la banca central aporriou-y a la economía un nuevu puxu, basada principalmente n empréstamu baratu. Pero l boom nun ye sustentable. El próximu accidente mal ye a penes una qüestion de tiempu.

La economía mundial anda n cursu recuperaçon: Una serie d’indicadores económicos ãpuncten andar spoxigando la producçon & el trabayu. Esti disinvolvimiento probabablemente se causa sobre maneira por polítiques monetaries n extremo flrouxes. Trés factores n esti contextu son de particular importancia:

1) Los bancos centrales tienen canalizades taxes d’interesses de mercau a niveles extremamente baxos. Esso deixa a los deldores arrefinancia’ les suês deldes a vencer cun nuevos impréstamos que cargën una taxa d’interes baxa. D’essa maneira los deldores son quien a obtener nueves facultaes de maniobra n materia gastu cun que les que stimula’ la demanda incrementada.

2) Los bancos centrales roblraren cun les suês acçones passades a los actores de les rules de crédito que nun diran haber futuramente mas incumplimientos de deldes statales & bancaries sobrecargades. Esso dissipara les preocupaçones de moratoria de la delda nes rules del crédito (el muxicu l systema de moneda fiduciaria). Los investidores cuenten agora cun que los bancos centrales in casu necessidá peremptoria anden preparaus pa poder xebrase de los perceptores de crédito n difficultaes que fhaigan pelligra’l systema finances, & proporcionando-yos el montante correspondiente de crédito & moneda que demanden. Los principales bancos centrales ponen ansí a disposiçon de los actores de les rules un seguru de balde, una “communya de bancos centrales”.

3) Les intervençones de la banca central camudarun nidio l comportamiento los investidores: la lherça al riscu baxou significativo. Los investidores tornen a andar dispuestos a pone’l sou denheiro n productos de riscu – & speren in casu problemas, que la banca central venga redimilos. (Fhala-se n esti contextu de “riscu moral”). Solo d’esta fhorma se ye a explicar que los deldores cun sobrecargu (tanto gubiernos cumo bancos) algamen nuevos empréstamos facilmente, & pa tras cun taxes d’interes historicamente baxes. La circulaçon de crédito anda de vuelta al cammin ciertu & imburria una nueva falsa prosperidá económica.

Los bancos centrales tornarun-se un participante activu nes rules de crédito

Esto ye, in toles grandes fhasteires monetaries creç el balance total – item la summa banca central mas el balance de banca negocios. Esta ye una sinyal inequívoca del obiectivu les polítiques monetaries: intervinierun nos últimos anhos cun vehemencia nes rules crediticies financiando u los bancos commerciales nun tienen possibilidaes ou nun quieren. Cun esso tienen cumo obiectivu torgar una ingurrie de la offerta total pendiente de crédito & denheiro – & por tanto torga’ les conseqüencies económiques d’un tal disinvolvimiento.

Los bancos centrales, ente tanto, volvierun-se quanto si mas un participante activu nes rules de crédito. Estos ya nun se limiten a emprestar a los bancos commerciales denheiro cul fin passalos al sector privau & a los gubiernos. Los bancos centrales autorealizen mas ou menos agora essi papel – por casu, pola acquisiçon títulos de delda de gubiernos, bancos & impreses directamente (& compres cun denheiro acabante crear a fin de pagar). La dixebra classica ente banca central per una parte & los bancos commerciales pela outra, fhoi basicamente (& visiblemente pal Mundo todo) eliminada.

Los bancos centrales tienen interes na inflacçon

Cumo resultau, esso significa, intamando, que un volume creciente de crédito se priende al capital activo netto. Esso reduz l amortiguador de perdiçon; los incumplimientos de pagu, casu occurrieren, son a assimilase n sin involucra’ los passivos del systema bancariu cun los sos creditores & depositantes. Lo segundo, los bancos centrales anden cada vez mas na diana: agora tienen un spoxigë significativu del riscu de crédito n relaçon cun gubiernos & bancos commerciales. Ansí, augmenta l incentivu políticu cul aciu expandi’ los bancos centrales la offerta moneda (ye dicir, a fin d’inflaccionar)  evitando incumplimientos de pagu a los sos deldores, fhaziendo communya cul lema: meyor augmenta’ la offerta denheiro, a fin de liquidar pagos pendientes, a suffrir perdiçones cul crédito.

La recuperaçon economica actual nun debe scurece’l fheitschu de que les economíes anden in cyclu expansion & recession cumo indenantea. El motivu: el denheiro fiduciario discobierto. Los bancos centrales, al in par cun los bancos commerciales, anden augmentando de continuo la offerta de denheiro por empréstamos bancarios. Mas exacto, la offerta moneda spoyeta por un crédito bancario que nun ye cubiertu pola economía real. D’essa maneira la taxa d’interes del mercau reduz-se so la suâ “taxa natural” (esto ye, el nivel que tien quando nun ha hi augmento artificial dalo que s’autorize d’offerta de crédito & moneda).

Les impreses anden tentades por investimentos non rentables

Les taxes d’interes artificialmente baxes incentiven les impreses a infrentar nuevos proyectos d’investimiento. A los consumidores & los gubiernos vuelve-se-yos attractivo vivir a crédito. Ansí lhouew creç primeiro la economía. Ceho ou tarde reparen intos les impreses in que los investimientos nun quadren – por spoxiga’ los precios de los factores producçon mas de lo que se calculara al intamu, ou por falha’ la demanda de productos sperada. Les impreses intamen reduziendo los investimientos non rentables. Eliminen-se trabayos.

La economía, que experimentara pol rendimiento la offerta crédito & denheiro inicial cabo les taxes d’interes artificialmente baxes un boom artificial, cai n una recession. N un puxu por xebrase de la recession-depression que s’aveira (que da veres ye una ruina correcçon de l allocaçon del capital que s’accumulou previamente), los bancos centrales reducen indagora mas les taxes d’interes & tenten d’aguantar in martscha l fluxu crédito & offerta denheiro. La “crisis” ye por tanto, “griesca” cul financiamiento que la causara primeiro.

Reaconteç una riestra de boom-and-bust – mesmamente los recientes cortes d’interesses & los augmentos de crédito & offerta denheiro acaben ermano, tamien arreventando. Esti conhocimiento económico ye opportuno: la recuperaçon económica global ye provocada – cumo ditscho al intamu – por una (ha dizise ya, historicamente) política d’interesses baxos in sin precedentes. Por tanto, paeç bien probable l retorna’ les economíes a un spanyíu secundau outra vez por una baltiada.
Non obstante, nun se deixa prever cun certeza quando serál próximu spanyíu & que ye lo que lu provocará. Sí que ansí deixen-se identificar daqué “elementos críticos” que merecen observaçon de mas cerquina cun vistes al funccionamiento del systema de moneda fiduciaria. Estos incluyen:

1) Les taxes d’interes

2) El declive la curva rendimiento

3) El disinvolvimiento d’empréstamos bancarios

4) La falta capitales proprios de los bancos

5) La carteira los impréstamos de cobru duldosu

1) Interesses al alza

Nun tien falta explicaçon que l spoxigë de taxes d’interes torne l boom n un spanyíu. Interesses crecientes equivalen a una puesta n martscha del motor, ta impobina’ la expansion económica artificial. Que actualmente los principales bancos centrales cumo l Federal Reserve de los USA & la Banca Central Europea (BCE) quieran eleva’ los interesses, fhairá aveirar cun certeza l boom del próximu reventon.

2) Inflexion plana la curva interes

Pal lucro los bancos, convien que les taxes de vencimiento a lhargo anden per riba les taxes de vencimiento a curtio (esto ye, quando la curva ye cuesta). Intos son quien a contraher empréstamos de vencimiento a lhargo que financien cun fundos – & d’esta maneira ameyoren la suâ situaçon de lucro. Una curva rendimientos horizontal (ou mesmamente inversa), ente tanto, actua cumo una pisada nel “freno l crédito”. Nos últimos anhos, les curves de rendimiento nos USA & na Eurolandia tienden de facto a tornase mas tyanes, pero anden indagora relativamente cuesta a riba & favorecen ansí les actividaes d’empréstamu de los bancos. N alçando los bancos centrales los interesses, el quadru probablemente dirá cambiar: les curves de rendimiento tornarán-se mas tyanes.

3) Aflrouxe la expansion del crédito

Pola expansion del crédito bancario manga-se cumo ya sabemus denheiro nuevo n cyclu económicu & elho puxa l spoxigë. In secando-se l fluxu, el boom vacila ou baltia nun stoupíu. Ta agora, ye l crecimiento económico por empréstamos bancarios in mũitschos paises (inda) la fhorma mas importante de producçon de perres – & los índices de crecimiento indagora son positivos.

4) Capital proprio de los bancos scoso

Cul fin produzir empréstamos & denheiro, a los bancos nun yos fhai falta solo denheiro de la banca central que reciben (abondo & barato) del susoditschu. Tamien yos fhai falta capital propriu. Al final, oblrigën-se a tornar a la exposiçon al riscu cun capital proprio  (impréstamos & títulos). Capital proprio (equidá), son los bancos a algamalo por lucros de retençon &/ou por augmento de capital de bancos exteriores. Lo primeiro requier de los bancos (poder) fhaer lucros, lo segundo requier la disposiçon de los investidores a querer investi’l sou denheiro nos bancos. Los bancos tienen ameyorada la suâ base de capital nos últimos anhos – pola reducçon los sous activos totales in relaçon al capital proprio.

5) Créditos cun riscu impagu

Ye parte l negocio bancario, que ende & alhende créditos se tornen impagos & falhen. Torna-se problemático quando los empréstamos a riscu (ye dicir, empréstamos nos que l deldor anda n una situaçon d’incumplimiento de pagos ou nun ye a pagá los interesses mas el pagu principal ou nun se lo ye a posibilitar) prevalecen. Intos normalmente consume-se rápidamente la capa finina de capital proprio de los bancos. Esta ye tamien la razon pola que l spanyíu n una economía altamente indeldada causa tan grandes problemas: elho amenaça la solvencia del systema bancariu. In mũîtschos países los empréstamos problemáticos son indagora relativamente altos.

La qüestion nun ye si, ma quando

Ha hi mũîtschos gattielhos concebibles possibles del spanyíu la bomba precios – crises geopolítiques, tschoque petroleiru, morosidá, etc. Al final ye l funccionamiento la máchina financieira internacional que determina si l augmento actual continúa ou s’interrumpe & cai n un restalhíu. Por esa razon, los puxos actuales de la banca central americana (Fed) son per-importantes: cumo banca central mundial directora determina l guelpe particularmente sobre les condiçones de coste liquidez & crédito nes rules financieires internacionales & por ende tamien les nacionales.

De facto ha-se de dir allerta: la Fed (co)provocara cun la suâ política monetaria los dous tschoques recientes de la puya financieira – la baltiada de la bolsa 2000/2001 & el spanyíu la bomba crédito 2008/2009. Un repuncte les taxes d’interes de les rules crediticies – cun causa por una txuba de taxes por bancos centrales nacionales ou por una txuba les primes de crédito- ye a lhevar a la explosion la borbolha precios iguada por bancos centrales cul sou systema de moneda fiduciaria. Visto económicamente nun ye un spanyíu del boom los precios nel systema de denheiro fiduciario una qüestion de si…, mas de quando?

Los actores les rules financieires ente tanto paecen agora andar enforma distendidos, esto ye, lo que deixen ver de cerquina los principales indicadores talos que primes de crédito ou volatilidá. Les preoccupaçones d’impagos d’impréstamos son baxos ou continúen declinando. Al in par, les expectatives d’inflacçon stan “adondades”. La impression de anda’ la situaçon de riscu subestimada, impon-se da fheitscho. Por nun tener que se’ les duês couses permanentes: los impagos son a prevenise poniendo n martscha les prenses electróniques de bilhetes. Pero esso impobina los precios a riba, trahi inflacçon – cumo ya tamien se ve evidentemente poles puyes d’acçones del sector financieiru.

Magar recuperase les economíes coyuncturalmente, cinquen quajsi que preses nel cyclu d’expansion & recession. Lo “traicioneiro” d’esto ye que, tal cumo indenantea, les polítiques monetaries extremamente expansionistas occasionen una continua assignaçon inadequada de capital. Magar esto último promove’ la producçon & el trabayu (pero provocando-lo la recuperaçon de la economía, lo que nun s’ha d’associar de maneira dala cun taxes de crecimiento excepcionalmente elevades), nun ye sustentable al txubi’ los empréstamos, frayará. Vista ansí la recuperaçon económica global, igual ye mũîtscho mas francible de lo que se tien communmente assumida.

Fhonte:

http://www.focus.de/finanzen/experten/polleit/konjunktur-wir-erleben-nur-eine-scheinbluete-der-naechste-crash-ist-schon-im-anmarsch_id_7237023.html

Maria Gadu

Mayra Corrêa Aygadoux, mas conhocida cumo Maria Gadu (San Paulo, 4 de deziembre de 1986) ye una cantante, compositora & gitarrista brasileira de Mùsica Popular. De magar el sou strenu, Maria tyamou l attençon de pùblico & crìtica, siendo indicada duês vezes pal Grammy Latino.

Biographìa

Paulistana, fhiya de Neusa & Moacyr Corrêa, los dos brasileiros, fhoi introducida a la pràctica musical inda na infancia. A los siepte anhos, ya grababa mùsiques en cintes de cassette. Fhixzo poucos meses de classes de gïtarra, lhuenye d’abondo pa interpretar partitures, pero abondo pa igua’ los sous proprios cantares. Fhixzo, de magar los trelze anhos, actuaçones en tschigres & fiestes de parientes nel sou San Paulo.

Mudou-se a Rîo de Xhaneiro intamando 2008, quando començou a tocar en tschigres de la Barra da Tijuca & de la Zona Sul. La suâ carreira ascendîu al accorda’ l attençon de famosos vinculaus a la sphera musical, cumo Caetano Veloso, Milton Nascimento, João Donato, ente outros. Maria Gadu spunctou al interpretar “Ne me quitte pas” de Jacques Brel, pal director Jayme Monjardim, que andaba n phase de preproducçon de la miniserie Maysa: Quando Fala O Coração. Maysa, cantante & maî del director, tuvo mũîtschu èxitu nes dècades del 50 & 60 cantando, ente outros, esti cantar. La version de Gadu fhoi lhouew incluyida na banda sonora de la miniserie que strenara n xhanheiro 2009, u la cantante fhixzo una participaçon special cumo actriz.

Intamando 2009, a los 22 anhos, Gadu preparou l sou primer album, homònymo, que se sacou pel selho SLAP, de la grabadora Som Livre, & cun producçon de Rodrigo Vidal. Pa tras, inceptou una campaña d’actuaçones nel Cinemathéque, na barriada Botafogo, in Rio. Lhouew de la salida l album ya mediau 2009, la cantante ganhou aina sitiu nos media brasileiros. El cantar “Shimbalaiê”, la suâ primer composiçon a los diez anhos, incluyîu-se na banda sonora d’outra producçon de la TV Globo, esta vez n horario noblre, la novella Viver a Vida. Ne me quitte pas arregrabou-se & , cabo “A historia de Lilly Braun”, incluye-se na banda sonora de la miniserie Cinquentinha, d’Aguinaldo Silva.

Gadu participou n una actuaçon del cantante & compositor suecoamericanu Eagle-Eye Cherry realizada na Via Funchal, in San Paulo, el 21 xhanheiro 2010. L actuaçon grabou-se pal DVD en vivo del cantante. Tamien participou nel CD & el DVD del album N9ve, de la cantante & compositora Ana Carolina, cantando la mùsica inèdita “mas que a mim”.

La banda sonora de la película Sonhos Roubados tien la participaçon de Gadu na fhaxa principal. La fhaxa homònyma salîu na Rede n abril & sacou-se pa promove’ la pellícula. Tamien en 2010, la cantante fhixzo una participaçon cun Xuxa nel sou “XSPB10” cantando la mùsica “O Leãozinho” de Veloso. Nel mesmu anhu, recibîu duês indicaçones al Grammy Latino nes categorìes Meyor Artista Revelaçon & Meyor Album de Cantante / Compositor.

N agosto 2011, Gadu participou nel concierto grabaçon del DVD de Chitãozinho e Xororó, en commemoraçon los 40 anhos de carreira del par. L eventu realizou-se na Sala Sao Paulo, na capital paulista, & contou cun la participaçon de la Orquestra Sinfônica Bachiana, del maestru João Carlos Martins. Cun Gadu, participàrun del eventu Caetano Veloso, Alexandre Pires, Fafá de Belém, Jair Rodrigues, Fábio Jr. & los fhiyos de Xororó, Sandy & Junior. La cantante tamien fhixzo una participaçon special nel album Umbigobunker?! del cantante & compositor carioca Jay Vaquer, nel sextu cantar del album, intitulau “Do Nada, me Jogaram aos Leões”. En Deziembre 2011, Gadu sacou l sou segundu album de studio, “Mais Uma Página” u la primer mùsica, “Axé A Cappella”, de Dani Black & Luísa Maita, fhoi sacada cumo cincielhu & disponibilizada pa discarga gratuita sol portal la cantante.

El discu tamien trahi la regrabaçon d’ “Amor de índio”, mùsica ya interpretada pola banda Roupa Nova, & cuenta cun la participaçon de Lenine & del cantante portuges Marco Rodrigues nel thema “A Balsa”

Maria Gadu casou cun la productora Lua Leça n 2013.

El 27 março 2015, la cantante publicou nel sou Facebook official una illustraçon confirmando la salida l sou tercer album de studio. Al final d’abril del mesmu anhu, la cantante confirmou la ediçon del sou nuevu discu, “Guelã” inda pel anhu 2015. El primer single del discu sacou-se pola cantante l 6 de mayo d’essi mesmu anhu & tyamou-se “Obloco”.

Cul èxitu “Guelã”,  fhoi grabau l DVD l 11 agosto 2016 nel Centro Cultural São Paulo.

Portal official:

https://www.mariagadu.net/

El spoxige d’osos abre una controversia ente ganaderos & conservacionistas

Asturias Ganadera pide a la Conseyería normes por augmento la presencia l plantígradu ayures nel pais & la Fundación Oso Pardo fhala de “allarmismo innecessario”.

In conferencia prensa fheitscha l xhueves, queixaba-se esti collectivu de ganadeiros de la falta intervençon de la Conseyería Disinvolvimiento Rural & Recursos Autóchthonos pol spoxige na cifra d’osos, cun un aveiramiento cada vez mayor del animal a casares & attaques a cabos de ganadeiría.

Ansí, requirierun el pagu los danyos fheitschos pol animal – bien de vezes attribuyen-se al osu, por pagase los danyos por lhobos un 10% menos – implementar un “teléphono l osu” avisando la presencia d’estos plantígrados ou l Individuar geneticamente los specímenes, n outros assumptos, evitando, in pallabres de sou, el repetise situaçones cumo les del lhobu ou l xhabardu.

Poles cifres dades por Asturias Ganadera, nes Asturies ha hi 240 cabos d’osu, considerando que seríen a cuti’ los 900 n una década. Quanto si mas, esti collectivu affirmou ser incierto tene’l osu pardu pelligro d’extinçon, phrase que rectificarun el díe spueis.

Ablucamiento

Pante esta postura los ganadeiros, la Fundación Oso Pardo affirmou andar ablucada “por una riestra d’annuncios allarmistas & in sin motivu del pelligro hypothético pa la ganadeiría de los nuessos osos & pa la xhente viviendo n campu”. Ansí, esti collectivu reconhoç “anda’ los osos cantábricos recuperando-se, non obstante indagora n dientro los criterios internacionales que fuerçen consideralos in pelligro d’extincçon”, addicionando carece’ les cifres del censu dades por Asturias Ganadera “de base scientífica & diffundir una informaçon irreal”.

“Los per-poucos incidentes ente osos & xhente que se reconhocierun nel postrer quartu sieglo, indiquen ser per-scasu pa la xhente l riscu hypothéticu del nuessu censu d’osos”, inciden los conservacionistas, per outra parte reconhociendo “haber inguanho mas expectatives de conflictu al rodiu de los casares, por quedar cada vez mas valeiros, u los osos s’aveiren, por poner un casu, a la geta fruîta”. Estos retos nuevos que infrenta la xhente tienen falta, avulta-yos, “d’una administraçon dynámica afhaziendo-se a cada coyunctura. Esto incluye poner in martscha l protocollo d’actuaçon cun osos conflictivos ou problemáticos que andamus reclamando a la Administraçon quantíssimo ha ya & que paeç andar a piques d’approbase”.

“La convivencia pacífica ente osos & la ganadería solo ye a combinase si s’afhiten & caltienen calces de collaboraçon ente l administraçon & el sector ganadeiru, & s’actúa poles duês partes cun tasa & xacíu”, resume la Fundación Oso Pardo, recordando la exsistencia de la Patrulha Osu nes Asturies de magar venti anhos ha resolviendo conflictos, & demanda a la conseyería intainar cun “valoraçon imparcial & pagu cabal de danyos fheitschos pol osu”.

Intergraphia

Fhonte:

http://asturies.com/noticies/laumentu-dosos-abre-un-alderique-ente-ganaderos-y-conservacionistes

Guariendo la canal radicular dental nel paleolíthico

Surprehendente discobrimiento

La broca l dentista nun sta acabante inventar – ya 13.000 anhos ha,  curiosos pulíen  los fhuracos de la caries dentaria cun broquines fheitsches de piedra ou wesso. Cumo obturaçon gastaben un retacu galipote.

Cul pan venierun los males de dientes. Los caçadores-recollectores nun teníen que se smolrecer mũîtscho cun la lhimpieza dental cun dieta de carne, fruîta, raizes & nuezes. Los descendientes, al volvese sedentarios coyeitschando grana & fhaziendo d’elho fharinha, acabarun cun los dentámenes sanos. L almidon apegaba a los dientes & iguaba un terreno fertil pa caries.

Pa de tras, cun la fharinha intraben piedriquines in pan, que da quando aflroraben & se mazcaben. Nel periodu neolíthicu, polo que sabemus agora, nun yeren solo agricultores, tamien nacîu la profession de dentista.

Interior del diente “modificau” 

Agora tienen discobierto los pesquisadores & l anthropólogu Stefano Benazzi de la universidá Bologna lo que igual ye l tractamiento dentario mas vieyo. Pouco inante d’ha 13.000 anhos, ya realizára daquien un tractamiento dental de dous incisivos laterales, por tanto al cabu l paleolíthicu superior.

El dentista practicaba d’aquelha nos montes de Riparo Fredian, a cerca de 75 kms al noroeste de Firenze. Incontráran-se ya ende ha camin de 20 anhos, so una lhábana saliente d’abelhugu, dientes de seys individuos.

Quando los pesquisadores los tornarun analyzar de cerquina, paecierun-yos los incisivos del individuo Fredian 5 particularmente impressionantes. Faltaba-yos la corona protecçon. & nos dous dientes los fhuracos de la pulpa, u s’atopa l nervio, yeren bien mayores de lo normal. “La cámara pulpar modificara-se n vida”, scriben nel sou artículu del “American Journal of Physical Anthropology“.

Raspiaços visibles

Daquien raspiára cun una piedra finina ou un wessu (el prototypu de la indagora wey temida broca de dentista) la parte de n drientro, eliminando lesiones de caries.
L avíu hôubo de ser extremamente dolorosu, specialmente por quanto yos vagaba l procedimiento, primeiro de ser incontrades fhormes significatives d’anesthesia. Coincidentemente les marques los raspiazos nel interior del diente nun podíen ser in qualquier casu prexsistentes por se’ los sucos abondo regulares.

Tamien zunes insalubres al mazcar, l usu regular de los dientes cumo fherramienta ou una modificaçon deliberada por moda ou razones culturales, podierun ser dischartades polos pesquisadores cumo causa.

El curiosu nun se limitou al fhuracu, fhixzo un trabayu óptimu & obturou tamien los dientes. Dientro les cavidaes, los investigadores discobrierun residuos d’una substancia scura: galipote cun inclusiones de partes de plantes & pelo, lhouew d’un examen mas minuciosu.

Procederes de dentistas que se documenten bien

“El galipote pudo usase cumo antiséptico” specularun los investigadores nel sou ensayu, “ou formaría una barreira antibacteriana ente l cuerpu & l ambiente”. La massa scura, antihumidá, in qualquier casu ya na Dómina de Piedra valía pa material de xhunctura & cumo un typu de supercola pa fherramientes. Dientes afhuracaus yeren d’aquelha, polo menos un pouco mas tarde nel períodu Neolíthicu, selhaus cun cera d’abeya.

Paeç polo contrario que lo que tien que ver cun les brengës de plantes & pelo ye indagora un mysterio. Nun ye claro si fhazíen parte de la obturaçon ou quedarun in fhuracu cul tiempu cun les sobres de comida.

Ente tanto, la xhente n paleolíthico sabía cuidadosamente cun que plantes podíen allivia’ les queixes. “Ha hi una bona documentaçon de casos ethnográphicos pal tractamiento l dolor de dientes, caries, inflamaçon de la raiz & outros symptomas”, scriben los pesquisadores.

El paciente vivîu ha de 13.000 a 12.740 anhos. Ente tanto, ha hi un casu mas vieyu de tractamiento dentario nel norte Italia. Na provincia de Belluno nel Véneto, archeólogos atoparan mal a penes ha diez anhos un molar cariau cun un tiempu d’ente 14.160 a 13.820 anhos que fhuera tamien afhuracau.

El trabayu sí que ansí ye menos precisu & la obturaçon nun se conservou. “El sitiu de la caries na parte de tras la boca fhairía mas dificil lhimpiar da fheitscho los dientes”, defenden ansí los auctores del studio al dentista mas vieyu.

Por mas doloroso que l procedimiento fhuere, el paciente paeç cun todo continuar viviendo posteriormente lhibre de symptomas. D’elho fhala polo menos el degaste pela veira superior del fhuracu. Probablemente nun podía solo comer, tamien podía continuar usando los dientes cumo fherramienta.

“Los raspiaços & el tener fheitscho romes les veires del fhuracu lheva a la conclusion que Fredian 5 sobreviviera a la exposiçon de la raiz del diente & lhouew diría poder continuar usando ta la muerte los dientes nes actividaes quotidianes”, scriben los investigadores. Per outra parte, cumo fhoi a aguanta’l dolor del tractamiento de la canal de la raiz nun se sabe. “Infelizmente, nun tengo respuesta a essa qüestion”, lamenta Benazzi.

Fhonte:

http://www.spiegel.de/wissenschaft/mensch/altsteinzeit-wurzelbehandlung-vor-13-000-jahren-a-1149017.html

Humanos, transhumanos, transsexuales

Los seres humanos siempre usarun la téchnica camudando la naturaleza, tanto l ambiente externu cumo los nuessos proprios cuerpos.

Ya ascuîtschemus mũîtscho de la xhente trans últimamente. Nun fhoi todo amable. Daqué fhoi specialmente feo.

Quadra que nun sou trans.

Pero sou transhumanista. Avulta-mi selo probablemente todos nós, ta un ciertu punctu.

Lo que quier dizir ye per-simple: avulta-mi nidio: Nun tene’ los humanos falta remanecer cumo intamamus. Outramente, el punctu de ser humano pa min tresciende la mera bionomía. Podemus ve’l camin a u andamus, & podemus decidir camudalu. Somus los únicos animales que son quien a dizir un creativu “No, agradecíu” a les couses proyectades pola maî. Los sous planes pa cun nós outros son mũîtsches vezes da fheitscho disagradables. Evitalos & iguar planes nuevos pa nós, ye daqué que habríemus celebrar.

Supperamus los nuessos límites naturales tol tiempu, & ye precioso. Infirmidaes disagradables: immunizámunos. Receitores del dolor fhuerte: tomamus morfina. Nun nacemus cun snales: iguamus aviones. Nun podemus fhalar colos muertos: miramus lhibros. & ansí successivamente..

Una marca importante de ser humano, cun certeza, ye un actu que tamien nos strema de quajsi que tola naturaleza: Los seres humanos gasten roupes. Fhexziéramus-lo de magar bien indenante  l nacimiento la historia. Fhaemus-lo pa evita’l frío, pero n climas cálidos fhaemus-lo igual. Mal pa insinyar a penes quien somus.

Ser humano tamien significa modificar conscientemente los nuessos cuerpos: ha cinco mil anhos, Ötzi, l home de xhielo, mangaba roupes. Tamien se tattuára. Los seres humanos practiquen la circumcision, fhaen perfuraçones corporales, scarificaçones – &  modificaçones corporales menos conseqüentes, cumo corte & coloraçon de pelo, perfumería & cosmética. Somus los animales que camuden. Siempre lo fhuéramus.

Los seres humanos son protectores. Todos habitamus a lo menos parcialmente n un mundo d’appariencies, capacidaes & fhormes corporales lhibres & conscientes de la nuessa elecçon. N una specie cumo la nuessa, alhouria-me l nun se’ lo trans mas commun de lo que ya ye. (confession: si stuviere lhibre riesgos, & podiere sfhaelo solo cun querelo, probaba-lo. Por que no?).
Si ye esso lo que somus, habíamus resolver divertinos cun elho, & fhaelo d’una maneira pa ser cada un de nós lo mas feliz possible.

Nun ando rogando sofhitar toles transiçones que qualquiera fhaiga cola suâ traça, cul sou cuerpu ou cola suâ propria figura. Igual delhos t’incomoden. Pero seguro que quajsi que ti presten outros cambios: camudances que fhexziesti, que outros fhehxzierun, & que nun fhairíes. Tien xacíu sperar star a communya cun todos? Claro que no. Pero paeç que cumo cun outres tantes couses, podemus reprimir ou vivir & deixar vivir. & n esso, sei de que parte stou.

Ye verdá sí que ansí, que you inda diba dir mas lhueñe. Pola miâ fhorma de pensar, querer passar d’un typu humanu determinau a outru – d’home a muyer – nun requier dala explicaçon. Cun certeza que daqué xhente va querelo fhaer. Querer cambiar ye simplemente lo que la xhente fhai, por tene’ les persones mentes, & ye esso que les mentes fhaen: figurase couses. Elhes alteren el mundo de la simple materia por paecese a la vida mental. Ye se’ lo que ye la naturaleza humana, talvez quanto si mas que los nuessos cuerpos masculinos ou femininos currientes. Seres luminosos somus nós…

Lo que m’alhouria pueis nun ye la xhente trans. Ye la xhente que passa l tiempu todo n esta sociedá industrial, incessantemente ideada, meticulosamente proyectada & mentalmente impregnada, esta sociedá iguada cun incontables violaçones deliberades & conscientes de la norma de la madre naturaleza – intos dizir que una lhende ye natural & un typu de cambio equívoco, ye falso ou tien una falta grande d’explicaçon.

Alterar couses, & camudar, ye exactamente lo que siempre fhexziéramus.

Fhonte:

https://www.libertarianism.org/columns/human-transhuman-transgender?utm_content=buffere53d4&utm_medium=social&utm_source=twitter.com&

Ta 95.000 catschiparros n un animal

Audio: 

Parásitos que per-tschupen ta morre’l alce

In Nueva Anglaterra, nel nordeste los USA & provincies canadienses fronteirices, disinvuelve-se un enorme drama animal. Muerren alces a maguyu, specialmente los xhatos. Baltien víctimes d’una invasion catschiparros que per-caven nes pelheyes d’estos portadores de grandes cornames. Los investigadores cuenten nos animales affectaus de 35.000 a 95.000 parasitas. Estos per-chupen les suês víctimes ta deixales anémiques da fheitscho: 95.000 catschiparros xhunctos son a consumir 45 litros de sangre, un alce adultu anda per 50 litros.

El censu queda demediau

L andaçu ya intamára pel anhu 2002. D’aquelha, al trabayar n un studio de la cabanha d’alces local, l écologu Peter Pekins, de la Universidá de New Hampshire, atopára xhatos muertos. Na pelheya, atopaben-se per-mũîtschos de los que se tyamen catschiparros d’hibierno, typu Dermacentor Albipitus. “Ansí intamou tol drama,” dixo Pekins al portal Inside Climate News. El specialista refirîu-se ansí al decline de cabos d’alce. “Na década passada n New Hampshire l censu spoyetára splendidamente”, alcuerda-se Pekins. “De magar aquelha, demediou-se la quantidá”.

Los catschiparros multipliquen-se explosivamente.

Magar remanecer los catschiparros nel lhogar, in quantíes pequenhes nun son a danya’ los alces. In se tornando los hibiernos poles alteraçones climátiques nel pais mas curtios & abondo templraus, bien mas d’arachnidos resjstierun la campanya fría & multiplicarun-se explosivamente. Da vezo, les temperatures stuvierun abondo per riba zero & tien-se formada una cobertoîra de nieve sólido n deziembre. Los alces adultos per-inflaquecen pol ataque & nun muerren immediatamente, pero los xhatos nun resjsten la perdiçon de quajsi que tola suâ sangre. “Na primavera mal a penes son un sacu pelheya & wessos” dixo Pekins.

Morrierun el 75 % los xhatos

Ayures pel norte, los arachnideos matarun al 75% los xhatos en 2013/14 & 2015/16 por torna’ la nieve tarde enforma. Magar haber ya repunctes xebraus del andaçu, agora ha hi los quajsi cada anhu. “Nos últimos oîtscho anhos tuviemus repunctes” affirmou l’ecólogu. “In sin precedentes da fheitscho”. Ende, los catschiparros nun son los únicos inimigos del alce. N América del Norte, fhai-se-yos un cocu que se yos tyanta nos sesos a criar.
Igual l alta mortalidá tamien rende la soluçon a la crisis. ”In morriendo tantos animales, remanecen menos podiendo sparce’ los catschiparros”, diz la zoóloga Kristine Rines del Fish and Game Department New Hampshire’s. Esto igual ye a fraya’l cyclu l infeste. Sí que ansí nun se ye quien a dizir quanto tiempu vaî vagar & si se recuperará la cabanha de cabos anterior. “La question ye si hemus de nos concienciar cun una massa de cabos a un nivel inferior”, dixo Rines, “ou hemus deixa’ los catschiparros mata’ los alces, que ye una muerte bederre”.

Varies soluçones pal andaçu

Con outres pallabres: debíen los caçadores reduzir cabos? Agora mesmo ye abondo discutido n New Hampshire. Naturalistas, pero tamien la xhente normal tien previstes soluçones que ya nun impliquen caçar mas. Nel portal Fish and Game Department la bióloga Rines compilou daqué recomendaçones. Una ye soltar pinctades. Podíen per-picotia’ los tschupa-sangres na pelheya los alces. Outros quexhieren mangayos a los alces un colharin antiparasitas cumo los que ha hi pa perros. Outres idees son dayos cun ceppilhos imbebidos n inseticidas, ou mandar robots in viescu & disseminar per ende los inseticidas.

Caçar mas alces?

Guardeses professionales consideren tales idees pouco efficientes ou mesmamente impracticables. Les úniques soluçones son ou para’l rescalecimiento global ou bien entesacar alces. Proponen reforçar un intentu de caça’ los animales n una area reducida. A partir d’un limite ciertu, les taxes d’infestaçon deberíen intos baxar. Pero nun se sabe quala ye essa lhende. Por ende, un de los studiantes l ecólogu Pekins examinou l problema na suâ tesina de doutorau. El resultau, el sou prototypu de cálculu: nel norte New Hampshire vagaríen-yos 15 anhos pa reduzi’ la densidá poblacional sufficiente. Si se baltien de 90 a 190 animales per anhu n cuentes de los 15 a 50 habituales, algamaba-se l limite n cinco anhos.

Pa tras, el cambio climático minaça los animales

Kent Gustafson, que impobina l administraçon del Fish and Game Department, quier, a communya cun “Inside Climate News” sperar fhaer tales acçones ta que Pekins & los sos collegas yos aporten mas conclusiones. La cousa mas facil yera deixa’ la naturaleza continua’l sou camin”, diz Gustafson. “Quanto si mas expandiendo la caça, esta solo diba ser una cura pequenhina n una mancadurona”. Pero a la lharga nun se sabe lo que passará. In 150 anhos, New Hampshire va tene’l clima de Virginia, por esso nun pincta bien in casu los alces, in sin importa’ lo que la xhente tente inguanho.

Fhonte:

https://weather.com/de-DE/wissen/tiere/news/zecken-gefallen-elche-population-halbiert-sich?%7Creferral%7Cwidget%7C%7Celche-zeckenhttps://weather.com/de-DE/wissen/tiere/news/zecken-gefallen-elche-population-halbiert-sich?%7Creferral%7Cwidget%7C%7Celche-zecken

Ich + Ich

Ich + Ich ye un proyectu alleman de mùsica popular, iguau polos mùsicos Annette Humpe & Adel Tawil.

Annette Hupe & Adel Tawil alcontràran-se pela primer vez na primavera de 2002 de casualidà n un studio de grabaçon de Berlin u Tawil cantaba n una producçon por incargu onde Humpe scribiera los textos. Al capta’ la voz de Tawil, tentou d’intrar in contactu cun elhi. Tawil ya yera conhocìu cumo miembru la banda A Boyz.

Un album a communya, que se sacarìa l 18 abril el 2005 surdirìa a partir d’esti alcuentru del 2004. El primer thema Geht’s dir schon besser? introu nes classificaçones allemanes el 8 noviembre 2004.

Du erinnerst mich an Liebe (fhais-me alcordame del amor) & Dienen (Servir) fhuerun èxitos drientro de los diez meyores n Allemania. In xhanheiro & febreiro l 2006 Humpe & Tawil fhexzierun una tournée bien exitosa n Allemania. Quajsi que toles actuaçones fhueran tyenaços da fheitscho. L actuaçon final de la tournée fhoi na Kesselhaus in der Kulturbrauerei n Berlin, de frente a quajsi que 2000 spectadores.

El segundu album de studio Vom selben Stern (del mesmu signo (strelha)) appaecîu n 29 xhunhio l 2007. El thema homònymu fhoi sacau n 15 xhunhîo & fhoi presente per 63 selmanes nes parades musicales allemanes, tornando-lu l que mas tiempu cincara nes lhistes de la banda.

A 9 noviembre 2007, el segundu single la banda fhoi Stark (fhuerte) que ya d’aquelha andaba n dècima plraça de les parades airplay allemanes & immediatamente intraría nes lhistes currientes nel nùmeru quattro.

El 4 abril de 2008, continuou-y So soll es bleiben, el tercer cincielhu l album, que algamou l puestu très de les lhistes, tornando-se l quintu top-ten exitosu de la banda n Allemania. L album strenou-se l 20 xhunhîo 2008, de pueis de 53 selmanes in puestu un nes lhistes allemanes. Cun mas de 1,25 milhones de grabaçones vendides & très cincielhos de platino da reo fhai de Von selben Stern l album mas exitoso del pop alleman ta agora.

In 13 noviembre 2009 salîu l tercer album de studio Gute Reise del que se sacou l single Pflaster. Cun esti fhoi la primer vez que txubîu al nùmeru un la lhista de singles allemanes, l album Gute Reise txubîu tamien al puestu nùmeru un & remanecîu cinco selmanes na mesma posiçon.

Ta inguanho, la banda vendîu mas de très milhones d’albuns.

N acabando agosto 2010 decidierun los dos artistas fhaer una pausa creativa & lhouew, concentrase n proyectos xebraus. “Spueis de siepte anhos, un tien que probar daquè nuevo”, dixo Tawil. El primeiru septiembre 2010 demintierun Humpe & Tawil tener sfheitscho la banda. “Fhaemus una pausa creativa, pero esso nun significa l fin de Ich+Ich”. La banda quixho cun todo termina’ la tournée n cursu, dixo la revista Bild a communya cola grabadora Universal.

Ich+Ich concursarun l un outschoubre 2010 n Bundesvision Song Contest 2010 n & pa Berlin cun Mohamed Mounir terminando los terceiros cun cien punctos.

Portal official:

http://www.ich-und-ich.de/

Economìa l incargu

Por que “la salude de los eventuales” importa.

Los trabayadores de la economía so incargu que per-xorreç son propensos a amalecer.

Ente mas se studia de cerca la economía so incargu, menos prestosa paeç. A aquelhos que se ganen la vida d’esta forma, polo commun trabayucando n plataformes, fundades n applicaçones que concasen les necessidaes de los consumidores cun trabayadores que son a complriles, consideren-se cumo trabayando n precario ou eventuales.

Wérganos cumo la Organizaçon Internacional del Trabayu characterizen esti typu trabayu mayormente cumo mal pagu & inseguru, u los trabayadores tienen poucos dreitschos & pouques protecçones sociales, organizacionales & legales.

Proveç la salude & la felicidá d’esta fuerça trabayu n rápidu spoxige, que ye de cerca 1,3 milhones nel Reyno Unido. Un académicu appella quanto si mas por un studio “Gighall” – que s’asemeya al marcu studios “Whitehall” qua salude de los funccionarios públicos.

Essos studios, que se tienen impobinaho per trés décades por Sir Michael Marmot, demonstráran la correspondencia ente status socioeconómicu & salubridá, una correlaçon que remanecîu conhocida cumo “syndrome de status”. Los funccionarios superiores gozaben de taxes minores de muerte & dolencies cardiaques que los funccionarios inferiores, una differencia adscrita n parte a l autonomía nel trabayu.

La sensaçon d’impotencia que baltia a mũîtschos de la economia so incargu (a communya cun una pesquisa, mal quattro de diez trabayadores n incargos a penes sienten se’ los proprios patrones), diz-nos que daqué problemas de salubridá anden dieldando n esta parte considerable de la fhuerça trabayu.

Un studio la fhuerça trabayu italiana, que se publicou l anhu passau n Social Science and Medicine, indica que aquelhos cun contractos temporales son mas propensos a usar medicaçon prescripta n trestornos de salude mental cumo depression (magar lo inverso tamien igual seya possiblemente verdá, que los problemas sanitarios prexsistentes inxhareten un trabayu mas irregular).

Magar nun ser specífico de la economía so recau, los auctores, de les universidaes de Bronel & de Milan, concluyen que l puxu por torna’ los mercaus de trabayu mas flexibles ye a volvese ruino pa la salude psýchica los trabayadores.

El trabayu so incargu fhai-se polo normal privadamente, in cotsches & lhares, cun bicycletes & cun motos, in cuentes de n un local de trabayu condivisu, ansí que los pelligros básicos, cumo l cansaçu associau cun hores interminables, son a passar inadvertidos.

Los trabayadores n incargos, que tienden a clasificase cumo contractantes independentes, nun tienen polo normal dreitschu a pagu por incapacidá ou compensaçon por lesiones. Esso diría poder camudar: una decision acabante tomar polos tribunales UK forçou Uber a reclassificar a los sos conductores cumo trabayadores por cuenta d’outru, in cuentes de contractantes por cuenta propria. (Uber appellará la decision de lantre tribunal esta seronda) Criticarun-se tamien impreses cumo Deliveroo & Amazon.

Ente tanto, Molly Tran, professora assistente de salude pública de la Universidá Stadual de Nueva York, vien d’instar a organizaçones professionales, cumo l American College of Occupational and Environmental Medicine, a ser conscientes los pelligros potenciales tocantes a la salubridá de los trabayadores associaus con la economía so incargu.

“Cumo specialistas in medicina laboral, tenemus una responsabilidá éthica fundamental de promove’ la xhusticia social”, diz nel Journal of Occupational and Environmental Medicine.

“La economía so incargu ye una “combinaçon tóxica” de ruina remuneraçon, ruines adiudes & fhuerte apuru, que significa a los trabayadores vagayos trabayar hores enforma pa algamar una renta básica”, scribîu la psychóloga Joanna Wilde, de UK’s Council on Work and Health, na revista Health and Safety at Work.

Tal trabayu precariu, diz Wilde, conhoç-se por ser pelligrosu pa la salubridá phýsica & mental, cun “falta d’accessu a les adiudes a la salude occupaçonal & a la incapacidá de pagar dala fhorma de seguru sanitariu que fuere a cubri’ la incapacidá de trabayar”.

Estos trabayadores, nota Wilde, tienen poucu tiempu pa participar n actividaes positives, cumo passar tiempu cun la familia, comer bien & sport. El resultau ye una txuba l agobiu, un factor implicau n dolencies cardiovasculares & mesmamente cancer.

Chris Yuill, professor de sciencia social médica na Robert Gordon University, n’Aberdeen, fhixzo pesquises a respeito de la salubridá n local de trabayu & acredita poder haber un patron de “salude de recadeiros”.

“Lo d’essa xhente poder trabayar quando quexhiere ye una illusion”, diz elhi.

“N Aberdeen ando per un sitiu u los moços s’alcuentren, solo sperando recibir una tyamada. Da vezo tienen preoccupaçones cun la salude & la seguridá, cumo tener de fhaer una cierta quantidá d’intrieges n un ciertu momento, pero qual ye l effeitu psychosocial d’andar sperando que l textu appaeça, diziendo que tienes ya l próximu recau?

“fhai-nos falta comprehende’ los effeitos, por associar controlalos cun bona salude”, diz elhi. “& ha hi bones indicaçones de que los trabayadores [na economia so incargu] nun tienen un nivel de control fuerte”.

Yuill afhalaga los studios Whitehall pero arresalta que los sous themas teníen in consideraçon trabayos seguros cun progression bien nidia de carreires. “Tenemus falta d’un studio ‘Gighall’. Camudou la maneira organiza’l trabayu nes nuesses economíes. La xhente trabaya n relevos lhargos abondo cul aquel de fhaer una renta básica. Tamien gasten los salarios por trabayar: “Les intrieges de correos privaus & taxistas mũîtsches vezes gasten-se n sofhita’ los sous proprios vehículos. Hemus d’intruganos: que ye lo que passa &, tamien, ye bono pa que? Produz un modu de vida que nos paeç metáthesis acceitable na nuessa sociedá?”, intruga. “La sociedá británica tien una lharga historia de compromisso por tener significau l trabayu. Cumo elho será nes fhormes nueves de trabayu ye l discursu que nos fhai falta tener. “

Fhonte:

https://www.ft.com/content/bdc90c22-408f-11e7-82b6-896b95f30f58#comments

Transplante de sexu: tattù tien que concasar cun color de piel

Los transplantes de puncta son raros. Suràfrica tien agora un casu special. Donante & receitor tienen una color de piel differente. N operando-lu, tattuaràn-lu.

Una puncta transplantada tien de concasar tattuando-la cola color del receitor. Un paciente negru de quarenta anhos tien la puncta d’un donante blrancu.

L annunciu fhoi fheitschu pol director chirurgìa plàstica de la Universidà Stellenbosch, Alexander Zühlke. La operaçon fhoi l domingo & salîu bien.

Lhouew de seys a oîtscho meses tattuarà-se-y medicamente la puncta cul aciu de fhaey concasa’ la piel clara de la puncta donada cun la piel mas scura l paciente, dixo Zühlke. Un tattù mèdicu ye asemeyau a unu normal (los pigmentos inxerten-se na piel).  Usen-se da quando por compensar differencies de pigmentaçon ou lhouew d’operaçones de restauraçon de tetones.

Quando l gruppo sangïneu ye ermanu, la color de la piel ye irrelevante.

Inantea d’operase informou-se-y al paciente que l wèrgano yera d’un blrancu, dixo Zühlke. El paciente nun tuvo problemas cun esso. Wérganos cumo la puncta donen-se rara vez. “Si l gruppo sangïneu & todo concasa, la color de la piel ye una caxigalina”, dixo Zühlke.

El paciente destinatariu la puncta perdiera-la lhouew d’una circumcision tradicional mal feitscha. Specialistas cuiden que solo por essa razon in Suràfrica tienen habides cada anhu ta 250 amputaçones totales ou parciales de puncta. Ta agora tienen habidos relativamente poucos transplantes de puncta

 Fhonte:

http://www.focus.de/gesundheit/news/medizin-nach-penis-verpflanzung-taetowierung-soll-hautfarbe-anpassen_id_7175925.html

The Brand New Heavies

The Brand New Heavies intamou na década de 1980 cumo una banda d’Acid Jazz instrumental tyamada Brothers International.

La banda creou l nome Heavies lhouew de roblra’l sou primer contractu de grabaçon, apanyando-lu emprestau d’una contra-portada n un single de James Brown que declaraba al artista “Ministru del Nuevu Super Heavy Funk”. Cumo The New Heavies ganháran cultu pela scena de clubs de Londres & lhouew roblraríen un Cooltempo al substituyi’l Acid Jazz al Rare Groove nos clubs.

La banda strenou-se cun Eddie Piller Acid Jazz en 1990 cun Jay Ella Ruth cumo vocalista. Un single, “Got to Give” salîu n Cooltempo inante de TBNH firmar cun Acid Jazz Records & sacar “Brand New Heavies” acclamau pola crítica.

La banda roblrou un contractu cun una division de la Chrysalis Records en UK, & la distribuçon americana fhixzo-la la influyente grabadora Delicious Vinyl, & N’Dea Davenport (que firmára un contractu d’evoluçon d’artistas cola Delicious Vinyl) axhunctaba-se a la banda. Sacou-se una version remocicada del primer album cun N’Dea de vocalista & los singles “Dream Come True”, “Never Stop” & “Stay this Way”, tornaríen-se éxitos n intrambes veires del Atlántico, cul cabeiru tornando-se un videoclip impobinau por Douglas Gayeton que fhoi promocionau fhuertemente na MTV.

L appaiçon de la banda cun MC Serch (primeiro cun 3rd Bass) & Q-Tip (de A Tribe Called Quest) n una session en Nueva York, inspirou la banda pa incorporar elementos Hip Hop. El sou próximu album será aclamaho pola crítica Heavy Rhyme Experience Vol. 1 incluyendo colaboraçones cun Guru de Gang Starr & The Pharcyde, ente outros, pero n sin voz feminina.

TBNH sacou Brother Sister en 1994, que fhoi l cabeiru album per un tiempu cun Davenport, que saliera pa completa’l sou album solina (que y proviciera por axhunctase colos Heavies). L album guariou mas cincielhos, magar un d’elhos, una version de Maria Muldaur “Midnight at the Oasis” mal fhuera popular a penes en UK al nun s’incluyir na version USA del album.

Siedah Garrett axhunctará-se a la banda pal album que diba venir, Shelter (1997). Contenía un éxitu minor, el cantar de cantares “You’ve got a friend” de Carole King que tornára famosu James Taylor. Outra vuelta, essa música nun appaeciera na version USA del album. Esti tamien contenía l éxitu “Sometimes”. El remix incluyía vocales rap de QTip.

2000 ta inguanho

TBNH sacaría d’aquelha l album de mayor éxitu de sou, Trunk Funk- The Best Of TBNH (2000) cun Carleen Anderson cumo vocalista n delhos themas acabantes grabar, continuando l album del Xhapon We Won’t Stop, cun bayura de vocalistas & Allaboutthefunk scripto & producido a commuña cun Nicole Russo (cumo se specifica na portada’ l album), que tamien se presentára cumo vocalista. Pal album We won’t Stop TBNH contaba cola cantante & compositora Sy Smith nel total del vocal feminin. El miembru inicial Jan Kincaid assumirá la direcçon de trés de los themas, & la poetissa de Los Angeles Gina Loring fhairá varies appariçones nel album. Si l son týpicu de los Heavies tenía sido mas funk stilu 1970 & tirando scontra mas a acústicu, en We Won’t Stop ve-se a la banda experimentando cun elementos electrónicos & R&B actual.

L album marcou la primer ediçon commercial de “What Do You Take Me For”, thema solitariu de la banda cola ex-vocalista principal N’Dea Davenport. El thema sería mas tarde regrabau n una configuraçon mas moderna cun Nicole Russo de vocalista pal album Allabouthtefunk. El son & los arreglos musicales ascuîtschaus n estes primeires ediçones de “Music”, “Love is…” & el thema “We Won’t Stop” regrabáran-se cun N’Dea Davenport cumo vocalista lhouew de retornar a  la banda cul album Get Used to It.

N abril 2006 TBNH reunîu-se cun N’Dea & el selho Delicious Vinyl. Un nuevo album, Get Used to It sacaba-se l 27 xhunhîo 2006 vía Starbucks & commercios minoristas tradiçonales. L album grabou-se n Nueva York & Londres, & el single “I Do not Know Why” fhoi sacau intamando mayo. El single rescampla por ser una les pouques ediçones serondes pa presenta’ la marca A Tom Moulton Mix cumo se y sollicitára contribuyendo cun remixes.

Mas tarde, el mesmu anhu, el thema “Jump’n’move” del sou Heavy Rhyme Experience Vol. 1 cun Jamal-ski fhoi sobresalîu na banda sonora de la película d’animaçon por computador Happy Feet 2006 & la banda sonora nel videotrebeyu NBA Live 2005 NBA 2k10. La banda fhairía una tournée al final de 2006.

TBNH sacou un album instrumental a discargase de la Rede tyamau Dunk Your Trunk en noviembre 2011. L album, que se grabára n solo quattro díes & se commentàra cumo “funky library music” impobinou-se cul aquel de que la “TV & xhente l cine fhueren a addicionalu a los sos programmas & pellícules”. El Dunk Your Trunk Remixed EP de 5 themas sacou-se a discarga l 1 mayo 2013.

El veniente album de TBNH, Forward, sacou-se l 6 mayo 2013. La parte vocal del album divide-se de fhorma uniforme ente N’Dea Davenport, presentando l sou primer single “Sunlight”, Jan Kinkaid & Simon Bartholomew, & la nueva vocalista británica Dawn Joseph. Ente tanto l album fhoi producido polos propios Heavies, cumo tolos sous albuns anteriores, tamien vienen nuevos collaboradores, incluyendo los compositores Johan Jones Witterberg, Marc Jackson Burrows, Rita Campbell & Tim Laws, & el téchnicu de son Toni Economides.

El 10 outschoubre 2013, TBNH annunciou pel sou portal que Dawn Joseph s’axhunctára officialmente a la banda cumo vocalista a tiempu completo & que la banda andaba trabayucando n un nuevo album de studio que se programmára a fin de sacase intamando 2014.

Jan Kinkaid & Dawn Joseph deixarun TBNH al final 2015 & N’Dea lhouew volvîu. En mayo 2016, TBNH annunciou dous próximos proyectos. El primeiru, un EP nuevo de studio cul títulu TBNHND programmau pa sacase pel estío de 2016 cun Davenport. La banda tamien annunciou la suâ intençon de sacar Heavy Rhyme Experience, Vol.2 en 2017, continuando l sou Heavy Rhyme Experience Vol. 1 del ’92.

En xhunhîo 2016, la banda inaugurou la suâ tournée n Europa & Xhapon cun Sulene Fleming de vocalista.

Miembros actuales

Sulene Fleming – vocalista (2016–wey)
Simon Bartholomew – vocalista, gitarra, productor (1985–wey)
Andrew Levy – baîxo, teclau, productor (1985–wey)
Matt Steele – Teclau, piano, programmaçon, synthetizadores  (2013–wey)
Luke Harris – Percussion (2016–wey)
Lily Gonzalez – Choros (2016–wey)

Antiguos Miembros

Jan Kincaid – vocalista, percussion (1985–2015)
Lascelles Gordon – percussion, teclau (1985–1992)
Ceri Evans – teclau (1985–1992)
Jay Ella Ruth – vocalista (1990)
Rob Cremona – teclau (1990—1991)
Jim Wellman – saxo (1990—1991)
N’Dea Davenport – vocalista, tambourin (1990–1995), (2005–2013), (2016)
Siedah Garrett – vocalista(1997–1998)
Carleen Anderson – vocalista(1999–2000)
Sy Smith – vocalista(2002–2003)
Nicole Russo – vocalista (2003–2004)
Dawn Joseph – vocalista (2013-2015)

Anticonceptivu “unisex” Investigadores atopen droga que “apaga” los spermatozoides

Si les muyeres son a preveni’ la prenyez de mũîtsches maneires, los méthodos limiten-se principalmente nos homes al preservativu – & ansí tien sido per millenios-. Pero agora los scientíficos anden trabayando n un nuevu méthodu contraceptivu podiendo-lu usar intrambos sexos. Podrá “apagar” da quando l sperma & evita’ la fecundaçon.

El sperma masculin tien dous lhabores: nadar & fhura’l wevu. Los preservativos stan ende pa para’l sperma inantea tyigar cabo l wevu. Ta agora, paecía se’l únicu méthodu de trabayu. Sí que ansí los investigadores de la Universidá de California discobrierun cumo se ye a prevenir efficazmente la perfuraçon  del sperma.

Cumo explicarun los scientíficos implicaus na investigaçon del méthodu al portal “Wired”, dizen andar trabayando n un contraceptivu d’usu por homes & muyeres & que effectivamente torga la fertilizaçon del wevu. El quid son ingredientes a base plantes, in daqué casos conhocidos ha sieglos.

Cumo se ye a evitar que l sperma fhure?

Pa un spermatozoide ser a fhura’l wevu,  ha tener fhuerça (los investigadores tyamen-lo “power kick”). Responsable ye la tyamada canal d’Iones CatSper. In tyigando l spermatozoide cabo l óvulo abre & deixa intrar iones de calcio de la parte la cola que valen de combustible na carreira. L abertura ye activada pola hormona progesterona.

Los investigadores busquen agora una maneira de torga’ la progesterona: sin hormona abertura dala de la canal ionica CatSper – & por tanto puxu dalu pa fhura’l sperma l óvulo. Nun ha hi fertilizaçon. Los investigadores teníen falta una droga asemeyada a la hormona & concurrir contra elha. Tyigarun a bon puertu.

Triumphu cun ingredientes a base de plantes

Cumo dixerun los scientíficos nel sou artículu na revista specializada PNAS, alcontrarun dous additivos adequaus: Lupeol que ye una substancia de plantes que ya s’andaba usando tractando la malaria & el cancer. Atopa-se n fruîtes cumo mangos & nel stongu l bedul. El segundu fármacu ye primisterina que s’obtien del arbol africanu Gymnosporia heterofylla.

“Agora podemus producir ya un mediu meyor & mas efficiente de contracepçon immediata.”, dixo la directriz d’investigaçon Polina Lishko n “Wired”. Cumo “Píldora l díe spueîs” les nueves substancies actives son diez vezes meyores pa torgar una fertilizaçon. Pero l fin yera un nuevu contraceptivu masculin – una alternativa a los preservativos.

L obiectivu: un contraceptivu unisex

En tanto, los experimentos de la commuña de pesquisa nun se completarun. Será determinada la dosis cierta de los ingredientes activos por experimentos cun monos inantea l fin d’anhu. Lhouew, la producçon intamará aina. Lishko tyama l resultau “contraceptivu universal”: intrambos homes & muyeres han de ser a tomalu. L effeitu colos spermatozoos ye l mesmu – queden “apagaus”.

Fhonte:

http://www.focus.de/gesundheit/news/unisex-verhuetungsmittel-forscher-entdecken-wirkstoff-zum-ausschalten-von-spermien_id_7149332.html

 

Traduziendo identidà pente la barreira l idioma

El vocabulario genderqueer n angles tyega a ingëdeyase abondo – fhalar in varies fhales trahi lhibertaes & restricçones.

Pa Elias, differentes fhales offrecen abelhugu differente. Fhiyo d’un paî magrebin & d’una maî americana, Elias crecîu ente Nueva York & Houston. Fhalaben mouro & angles in casa. El paî d’Elias assegurou-se de que la familia mal fhalare a penes mouro na mesa xhantar in ciertes lhacuades, n un puxu por retener una connexion cun la fe islàmica & la herencia moura de la familia. D’ente los ermanos, Elias fhoi l ùnico a apprehende’ la lhingua abondo, fhaziendo-la parte la vida diaria.

Si l angles ye la lhingua que Elias fhala cun mas freqüencia, el mouro ye la lhingua la suâ fe. “Adiuda-me mũîtscho cun la connexion cun Dîous”, dixo-mi elho per teléphono. Ye la lhingua que Elias fhala cun la suâ moça tamien, una activista siria, quando nun quieren que l mundo exterior golifle nes suês tscharres. “En pùblico & buscando privacidà, essa ye la fhala patron pante nòs outros”, diz Elias. Teniendo Elias cumo tien difficultaes auditives, la lhingua americana de signos val-y cumo fherramienta – specialmente quando elho anda ayures pelo alto ou simplemente n un sitiu agobiante por de mas. “Si me siento opprimido n un spacio & nun me siento a gusto fhalando, fhaigo un ademan (apprehendì-yi a al mîou moço delhos ademanes por si mi diere por mangame n plan mudu), & elho lo pescancia cumo “Val, esso ye lo que tengo falta saber”.

La identidà de condiçon non binaria d’Elias ye mũîtsches vezes fhonte de velea. Si bien la fhala ye a offrecer alliviu, tamien ye a inantar capes de complicaçon. N angles, ye theoricamente facil contornia’ lo binario de la condiçon: la xhente genderqueer ye a declara’ los sous pronomes preferidos, & el resto l mundo mal ha d’honrar esses preferencies a penes – cumo fixci you scribiendo esti artìculu (Elias prefier los pronomes elho/lo). Per outra parte, nun s’atopa siempre n spacios u seya tan facil. Elias ye una educadora sexual de 24 anhos que anda sacando una maestrìa n photographìa na Universià Howard, & elho s’identifica cumo de “condiçon fluida” (quier dizir poder habitar mùltiples condiçones al mesmu tiempu ou fluctuar ente elhes). Por elho, Elias ha d’arrenegocia’ les suês expectatives & la suâ presentaçon in drientro differentes spacios, basando-se n si outros reconhoceran la fluideza de la suâ sexualidà.

“Los mîos professores tienen accessu al mîo nome de nacimiento. Intos, diendo pal campus, andaba you n plan -Val, esta ye una situaçon u me van degenerificar-“, dixo. In campus Elias dá-y a un interruptor, & lhouew dá-y outra vez quando sal. “Los mîos amigos & la miâ rede social & los mîos moços & les persones cun les que vivo, tol mundo usa l nome de la miâ elecçon, los mîous pronomes. Polo tanto essa parte ye decente. Pero ye frustrante da fheitscho & repuna abondo. Camudando constantemente”.

En mouro, talvez seya mas dificil arrodia’ lo binario l gènero, al presenta’ los verbos da quando fhormes masculines ou feminines. Pero la fhala val cumo retiru privau, seya na vida spiritual d’Elias ou na vida cun la suâ moça. Los dos iguarun un alcuñu mouru pa Elias, combinando la pallabra moura habibi, un tèrminu masculin d’affectu cumo “estimau” & la pallabra “boi”, usada al expressa’ la variança de gènero nes commuñes LGBTQ de fhala anglesa. ” Inventou-lo primeiro la miâ moça . Elha diba-me tyamar baby boi & arreparou que n tyamando-me habibi podìa mangay el boi angles al final & discurrir un tèrminu nuevu.” Elias tien agora un tattù que diz Habibiboi nel sou bìceps.

Xhente de condiçon fluida, cumo Elias, fhaen parte d’un spectro xhente que nun s’identifica cumo binario. Al tener puestes mũîtschos idiomas restricçiones a la expression de la condiçon, xhente non binaria implica-se da vezo cun la grammàtica n un nivel mũîtscho mas fhundeiru de quien s’assigna non binario. Les suês relaçones cun la fhala son ingëdeyades & profundamente personales. Magar esti implique cun la fhala podia ser duru pa la xhente que vive n una sociedà que nun los acceita plenamente, ye tamien una maneira promove’ la visibilidà l genderqueer; los activistas non binarios fhuerun a atopar maneires de camuda’ la fhala nun teniendo falta ser tan vulgares.

Los anglòphonos ya gasten el singular “they” tol tiempu, por esso ye abondo facil figurase cumo essos pronomes han funccionar. Delhos de los que s’opponen al “they” singular na xhente genderqueer affirmen que l interes de sou anda n preserva’ la pureza la grammàtica anglesa. Al cuentu, n una intervista l mes passau, el professor de sciencia psýchica de la Universidà Toronto, Jordan Peterson, dixo esto de los pronomes non binarios:

“Nun reconhoço l dreitschu d’outra persona a decidir quales pallabres vou utilizar, specialmente quando les pallabres que quieren que you use, da primeires, nun son elementos patrimoniales de la fhala anglesa & son construcçones d’un pequenhu cotarru xhente motivades por doutrines. Son a tener un punctu, pero nun direi les pallabres que quieren”.

Si una parte los alumnos protestarun contra les observaçones de Peterson, outros notarun rapidamente que nel sou argumento contra “elementos non patrimoniales del angles”, precisamente l singular “they”, Peterson gasta da vezo l “they” singular el mesmu. Ye probable por, magar mũîtschos manuales de stylu dizir se’l singular “they” incorrectu, andar mũîtschos fhalantes d’angles usando-lu tol tiempu.

Gretchen McCulloch, una linguista que scribîu de la fhala non binaria, diz haber argumentos tanto linguìsticos cumo polìticos cun la utilizaçon del “they” singular. “Nòs andamus usando-lo n delhos contextos ya ha mũîtschu tiempu”, dixo-mi elha. Por casu, magar los grandes puxos de los grammàticos por lhibrase del “they” singular, si daquien deixa un paragues scaeicìu n un restaurante, sona mũîtscho mas natural dizir “Someone left their umbrella here” que “Someone left his umbrella here” (nota: he deixar in sin traduzir por fhaer rescampla’ la differencia), “Daquien deixou l sou parawes ende” una tentativa mas contemporanea por parte los grammáticos d’evitar “they” singular”.

Que l “they” singular realmente sone natural tien xacìu cul restu l idioma angles, segun McCulloch. “La idea de que una vez un pronome ye plural siempre ha ser plural nunca fhoi l razonamiento disenvueltu pol angles”, explicou. El casu mas nidiu ye la pallabra “you” que yera exclusivamente plural. McCulloch dixo que al principio “thou” (tu) yera exclusivamente singular & “you” (vòs) yera exclusivamente plural. Wey, “thou” disappaecîu del angles moderno, & “you” ye a ser singular ou plural.

La opposiçon al singular, segun McCulloch, sal del mesmu puxu que impobinou a los grammàticos a opponese a outres structures grammaticales communes n angles, incluyendo infinitivos & phrases dividides que terminen in preposiçones; anden tentando d’amolda’l angles a la grammàtica de les lhingues clàssiques & romàniques. “Essa idea de nun se poder dividir un infinitivo vien de la fatada de la mala applicaçon de la grammàtica lhatina”, dixo McCulloch. “En lhatin una expression cumo “to go” ( dir – he de deixalo sin traducçon na fhala ende por day sentìu ) ye una pallabra. Ye incoherente da fheitscho tentar de dividir una pallabra cumo essa & collocala “a lo bravo” in medio, n angles son duês pallabres. Nòs ya lo scribiemus cun un spacio ente elhes, siempre lo fhexzièramus” .

McCulloch spera que l activismo genderqueer convença a los grammàticos acceita’l singular, non solo cumo  pronome non binariu, ma tamien cumo ya s’usara da vezo. Nun ye la ùnica: In 2015, L American Dialect Society nominou “they” singular la pallabra l anhu.

Usar “they” refiriendo-se a individuos specìficos que son genderqueer ou non binarios ye una innovaçon acabante crear, que a McCulloch y diz tener mũîtschu xacìu – non por nun dir aculhà de cumo los fhalantes d’angles ya gasten el pronome, ma por ser abondo distincto dando-y a la xhente genderqueer una maneira de marca’ la suâ identidà. Ente tanto delhes lhingues, cumo l mouro, tienen el gènero que se codifica profundamente na fhala meyor que l angles, bien d’outros cumo l malayo, el bengalin & la lhingua americana de signos nun tienen gènero grammatical dalo. (ùltimu, por casu, in cuentes de referise a la xhente cun los pronomes elhi ou elha, uno refier-se a persones differentes, attribuyiendo-yos una posiçon nel spacio. In malayo, elhi & elha son la mesma pallabra (cumo son sou & suâ, etc…). N idiomas cumo essos, nin los pronomes nin los verbos revelen si l subiectu ye masculin, feminin ou genderqueer, & esso quier dizir que nun se dirá malinterpretar persona dala – al nun se reconhoce’ l sou gènero (ou la falta d’elho). N angles, usando “they” refiriendo-nos a persones non binaries individualmente, nun solo evitamus malhumoralos, ma reconhocemus la suâ identidà non binaria.

Un amigo mìo & colhaço scribiente, Charlie Tetiyevsky, concordou que adopta’l singular “they” por xhente genderqueer ha ser simple. Axhunctàmunos n un bon dìe pela seronda n Los Angeles por fhalar de gènero & idioma, & Charlie contou-mi cumo, indenantea nacer, la suâ familia migrara a Norteamèrica de la Union Soviètica; creciera n una casa de fhala russa n Nueva Jersey. Mesmo quando yera pequenho de mas nun podiendo intende’l gènero non binario, elho andaba ya de vuelta. In casa, fhalaba russo, na schuela, traduzìa del angles al russo a la maî.

Magar seya l russo la primeira fhala de Charlie, ye tamien una cun la que hôubo bregar al  passu los anhos. Charlie dixo de los pronomes russos nun solo tener gènero, ma que pa tras,  les coses camuden consonante al sexu la persona que fhala d’elhos. (Por poner casu la pallabra pal mus na phrase “el mîou mus” camudarà si l mus perteneç a un home ou a una muyer). ” Ye un paquete inteiru, cumo un paquete gènero que se y intrega a unu & ye per-engëdeyaho poder calculalo” , Dixo-mi Charlie, que piensa ser parte la razon pola que, in fhaziendo-se mayor, tuviera torgës al tentar de caltene’ la fhala . “Nun sei si ye pola miâ propria fluidez de condiçon, ou si ye por ser obstinaho & nun querer apprehender 23, quanto si mas, 21 categorìes differentes de couses. Probablemente ye un pouco de les duês couses”.

En comparança, Charlie dixo nun haber de ser difficil quita’ lo binario del gènero del angles. “Yes a collocalo n outra perspectiva, mal camudando una ou duês pallabres a penes. Que ye lo que nos atrassa intos cumo cultura? Veo que elho sta torgando a los oradores russos. Pero, & a nòs outros? La nuessa disculpa ye solo dizir que “they” fastidia ou ye raro? Bona disculpa nun ye”.

Poles difficultaes del gènero n russo, Charlie evita da primeires fhala’ la lhingua, excepto occasiones rares al telèphono cun la maî. Charlie nun ye l ùnico na suâ preferencia por evita’ los idiomas que lo son a forçar a gënerificase mal elho mesmo.

Nai, que tamien ye de gènero non binario, tien un don d’idiomas per-extraordinariu, differente de qualquiera outra persona que you atopara. Elho creciera diendo a una scuela bilingue, deprehendiendo hispañol & angles, pero fhala varies lhingues romàniques, cabo outres lhingues tan diverses cumo l farsi, russo &  mandarin.

Nai tien fheitscho trabayos de traducçon de magar los 13 anhos. Quando y mentei avulta-mi impressionantes les suês habilidaes, Nai sacou-y importancia. “Sei que la xhente lo ve cumo de ser per-dotaho, pero pa min mal son a penes patrones mentales. Tengo algorithmos mentales” dixo. “Da veres, toles fhales romàniques que fhalo, paecen-mi una lhingua sola. Avulten-mi ser mas dialectos que lhingues”.

Nai explicou poder adivinar una pallabra n una fhala cun base na suâ traducçon n outra, cumo la pallabra “voyage” que se torna viaggio n italiano, viagem in portuges, viyaje n hispañol (sic! ansì nel textu fhonte) & continuando ansì “Los mîous algorithmos funccionen el 90% del tiempu. & intos memorizo los cabeiros 10% in cuentes d’haber de memoriza’  los 100%”.

Pero si Nai anda a gusto cola suâ identidá genderqueer, elho anda mũîtscho menos a gusto cun mũîtschos d’estos idiomas. “La mayoría d’elhos tien gènero binario, que mi ye per-extraño. Da vezo you solo… da veres nun fhalo tanto cumo avezaba fhalar primeiro” dixo. “Agora sou mas consciente de nun m’andar expressando authènticamente da fheitscho scoyendo una condiçon binaria”.

Magar Nai fhalar eses lhingues menos de lo que lo fhazìa, indagora nun ye a evitar pensar n elhes. “Enriedo cun les miês fhales & cuesta-mi mas remanecer n una, sobre maneira stando canso, dixo. Nun podiendo parar de blrincar pente differentes lhingues nos sous pensamientos, iguou grammàtiques personalizades na cabeça. N hispañol, un casu, in cuentes d’usar “o” ou “a” que signifiquen condiçon masculina & feminina, respeitivamente,  (como cun les pallabres “latino” & “latina”) Nai usarà “e” (Latine).

Da quando, si que ansì, Nai nun ye a evitar fhalar cun mas intensidà lhingues condicionades al alto la lheva. Martschou a Russia, u tien raigañu, pero u expressar qualquier typu d’identidà extraña serìa arriesgase. In Russia, Nai inda fhairà lo que bonamente podiere affirmando la suâ identidà, mesmamente remaneciendo un tanto discreto

“Una cousa que fhaigo – & sei que mũîtschos trans russos fhaen – ye abondo commun: nel discursu tragase les terminaçones”, dixo. Xebra’l fin la pallabra ye a sacay lo binario al gènero, por ser da vezo u l gènero se codifica. Charlie notou-lo tamien In russo. “Ye tan prestoso que nun pares de fazer trampa! “ dixo. “Solhettrar, solhettra-se da fheitscho differente, pero si lo dizes flrouxo abondo, sona ermano ermano”.

Intrugëi-y a McCulloch que si hôubiere persones abondo empeçando a tragase l final de les pallabres In russo, esses terminaçones simplemente dirìen disappaecer. Dixo haber varios factores, pero “ha hi un precedente de fhala cambiante u l gènero se torna menos importante. Da quando, esso ye l resultau de fhormes que son dischartades ou perdides, in particular al final les pallabres ou n posiçones in sin importancia d’una pallabra. Pero si l accentu se mangare n riba la primeira sýllaba una pallabra, intos les sýllabes posteriores tornaríen-se menos importantes”. Da quando les terminaçones gënerificades seran perdides da fheitscho.

Si la communidà de genderqueers serà ou non a innova’ la fhala mainstream, indagora falta confirmase. McCulloch contou-mi cumo la communidà genderqueers israelina andaba alterando l hebreo, un idioma de gènero bien codificaho, trespassando la suâ identidà non binaria. N hebreo, los verbos tienen da vezo gènero na primer & segunda persona, ansì cumo na terceira.

Cun la intençon de tractalo, los voceiros hebreos genderqueer van & vienen. “Si tienes duês opçones de gènero n una phrase determinada, uses el masculin n una & el feminin na outra, ansì nun te cases nin cun uno nin cun outro, solo andes moviendo-te seliquino n sin problemas”, dixo McCulloch. D’accuerdo cun Ilana Masad, scribiendo sobre condiçon & hebreo n The Toast, los fhalantes d’hebreo non binario inrieden cun outros aspectos de la grammática hebraica tamien, incluyendo les terminaçones.

Iguando essencialmente una nueva gramàtica hebraica pante si, la communidà genderqueers israelina tamien xorreç in visibilidà. Masad scribe:

“Atopei-me cun esta historia creyendo nun haber cambio positivo dalo cun la naturaleza condicionadora de los pronomes hebraicos, pero una commentarista, Jane Harris, que fhoi arrogante abondo participando n esta discussion cun migo, dixo esto:Ye gracioso cumo l hebreo y dá puxu a los genderqueers & outra xhente trans que anden out, & yos deixa usa’l sou proprio gènero grammatical (sic), pero y convence mas pouco a xhente que anda in , que al referise a si mesmos, cai-yos un recordatorio n riba”.

Outres fhales generificades tamien anden camudando cul aciu de dar mas visibilidà genderqueer. Unu de los casos meyor resueltos ye la “x” n hispañol arrepresentando les vocales de gèneru. El tèrminu Latinx ye cada vez mas commun inguanho, specialmente si se freqüenten les fhontes media millenials cumo VICE, BuzzFeed, Huffington Post, Mic & Fusion.

Si la suâ innovaçon na fhala anda ganando attençon massiva, ou si solo ye una maneira d’incontra’ la paz cul sou spìritu, expandi’ la inclusividà de la fhala ye daquè que McCulloch, polo menos, defende: “Fhala ye lo que nòs collectivamente fhaemus. Ye mũîtscho mas interessante l puxu d’una persona intentando tornalo n daquè mas inclusivo & mas versatil, que una banda grammàticos repunantes del sieglo XVIII diziendo d’haber fhaelo cumo l lhatin”.

Mesmamente si los pronomes preferidos d’Elias son they/them/their, da quando podrìa  figura-se, que daquè meyor podía appaecer.

“basculo n una scala masculin-feminin-dalo-intrambos, por existir una scala de quattro punctes , & you fluyo pente todes elhes & da quando pente dala, they/them/their presten-mi, pero nun son representativos de la condiçon que m’acouta”, dixo-mi. “Mal ye un spacio reservaho .”

Con base nes miês tscharres n esti artìculu, so ende ha hi una bayura territorio linguìstico por explorar:

El glossario Nonbinary.org de fhala neutra de gènero ;

Una lhista pronomes non angleses neutros em tèrminos de gènero ;

Esta intervista cun una activista russo LGBT autista del sou usu de la lhingua.

ETC.

Fhonte:

https://howwegettonext.com/translating-identity-across-the-language-barrier-66a87163a8e1

P.S.: transcribo el”they” singular por “elho

80 Anhos de Zeca

Audio:

Mîou ermanu, arrimaho ha dous anhos a pueis d’haber ido a saltu, vieno de Francia ende per 1968. Sta eiquì sta a fhazer quarenta anhos. Yera un tiempu n que ls suenyos se dizìen in frances & el mayor infierno se tyamaba Gerra d’Ultramar, que solo algo a pueis deprehendì que yera una gërra colonial. Quien stubiera fhuera & nun veniere a presentase pa la gerra yera dadu cumo desertor & lhouew presu si attentare a poner pie na suâ tierra. Extranya patria que ãpunctaba ls sous fhiyos pel mundo a saber de la vida & els oblrigaba a venir pa integrase a una gerra que naide intendìa pa que servìa & de que se scapaba quien podìa. Un tiempu de vergonça, ansì me lhembro d’elho.

Vieno l mîou ermanu, & todo quanto trôuxo cun elhi de Francia fhoi una bicicleta mudances, un xhiradiscos & arrimaho a una douzina discos. Agosto currìa, marralheiro, ya cola trilha fheitscha, & sobraba l tiempu pa ascuîtschar aquelhes modes a que les miês oreyes nunca habìen podido tyigar. Nin sei cumo l discu nun se gastou d’ascuîtschar tanta vez «Os Vampiros», «Menino do Bairro Negro» & «No lago do Breu», modes d’un tal José Afonso, del que nunca ascuîtschàra fhalar. Un dìe, el discu scatschou-se, mas les mùsiques ya les grabàra de cantales tanta vez. Ansì & todo, solo le tornei a ascuîtscha’ la voz ya n 1972, n una Bergança que abafhaba. Un amigu arranxhàra un discu tyamadu «Cantigas do Maio»: habìa que ascuîtschar a les scondides, el son baxicu pa que nun tyigare a la calexha. A pueis, a pueis fhoi ta siempre, indagora companyìa, nunca cansada, de les lharges travessìes de Lisboa a Sendin & a Vila-Real.

In quanto speraba ascuîtscha’ la Grândola Vila Morena, na madrugada de 25 abril 1974, nel Depósito Geral de Adidos, tenìa un nuelu tan fhuerte que nun sabìa n que parte l cuerpu se mi diere. A pueis, fhoi un arrevientu, cumo una nueitsche de fogetes de lhàgrimes, cumo si aquel que «Era um Redondo Vocábulo», argolha d’una cadena, se spatiçàra. Solo a pueis d’essa nueva era lu ascuîtschei cantar algunes vezes de viva voz & fhui coinciendo tola suâ mùsica per uns lhados & per outros, ya que nin denheiro tenìa pa xhiradiscos & esses couses. Tuvi inda que sperar mũitschu anhu pa axhuncta’ la colleçon de les suês mùsiques, que continu1o a ascuîtschar n una ruedra que vaî demudando.

Cun elhi tamien deprehendì a dar valor a modes que ascuîtschaba sde pequenhu, anque n Mirandes, cumo aquel «Dius te guarde Rosa, / Lindo Çarafin, / Linda pastorica, / que fazes eiqui?». & d’outres nun fhalo, que prefiero ascuîtschar &, al mesmu tiempu que ascuîtscho, ir viendo ls cinemas in que ls sonidos se sroben in drento. Nun sei por que, ma ha hi pallabres, ha hi sonidos que se vuelven colubrines de cada vez que les ascuîtscho. Nun adelantra una persona querer intender esses couses, abonda ascuîtschar. & pensar, mas una vez, que ciertes persones nunca s’habìen de morrer.

Un dìe, vaî fhazer venti anhos esti febreiro, staba ascuîtschando l telejornal & ponen aquelha moda d’outonho que manda calhar fhontes & tyorar ribeires & todo, «que eu não volto a cantar». Tamien ende you le pedì alguna awa a les ribeires & me calhei cumo les fhontes. Yera 1986 & la miâ vida staba a dar un vuelcu cumo una campana, n un fhuelgu que inda mal daba senyes d’agarrar un nuevu equillibrio. Nun mi dîou la gana dir al intierru, pa quedar cun la illusion de que nun morriera & nun deixàra de se’l que siempre fhuera, una ambuça de sonidos que se suerben. Ta hoxhe elhi mi continua cantando, siempre cumo si fhuera la primeira vez. Quando ascuîtscho les suês modes, mas que de José Afonso, lhembra-se-mi de min. Ye una mùsica que m’imburria a contra de min, sde aquel Agosto marralheiro de 1968. Non cun sinhalrdaes, ma cun gana d’hoxhe, & de continuar sonyando cun una tierra de fraternidàde. Cun mùsica que fhaiga volar, nin que seya solo a catschicos, que ye un modo de nun se sabarrar tanto nos tropieços del camminu.

Transcripçon inter del mirandes

Fhonte:

http://80anosdezeca.blogspot.be/2009/10/texto-escrito-em-mirandes.html

Guayana, plan de gubierno refugau, negociaçones suspenses.

La nueitsche fhoi lharga n Cayenne. El Ministru d’Ultramar incontrou-se cun una delegaçon d’una cinqüentena de Guayaneiros, per nueve hores, ente 18:30 & 3:30 (ente 23:30 & 8:30 n Paris ). Les discussiones cul gubiernu fhueran suspenses pela manyana l domingo dous d’abril na Guayana, u l collectivu portador de la mobilizaçon social arreclama da fheitscho un “nuevu status” pa esti territorio lhouew del annuncio de cerca un bilhon d’euros in compromissos assumidos polos ministros Matthias Fekl & Ericka Bareigts. Faltando l accuerdu, les discussiones han retomase l domingo a les 11 hores na  prefeitura (16 hores in Paris), indicarun los participantes.

Pa los differentes pólos del collectivu Pou Lagwiyann dékolé (“Pa que la Guayana se ponga n martscha” n crioulho), les couses son nidies: les cuentes nun salen. Xhusticia, Educaçon, Segurança, Salude, la riestra medides in riba la mesa “apremiantes”, delhes diendo-yos vagar ta diez anhos, nun terminou de momento cun duês selmanes de protestes multiformes.

A los weyos del collectivu, el gubierno nun tomou seriamente los atrasos que s’accumuláran per décades pola Guayana. La delda l stau frances & les necessidaes peremptories por attender fhuerçen un movimiento que alça & axhuncta la poblaçon la Guyana cun occasion d’esta mobilizaçon histórica.

Lhouew del annuncio l gubierno, la reacçon de Mikaël Mancée, unu de les cabeces del collectivu “500 ermanos contra l crimen” a la cabeza l movimiento protesta, fhoi amarga: “La primer sensaçon ye que nun nos ascuîtschen. Bien de couses constáran ya da veres n acta. De los grandes annuncios que sperábamus, Urbe Xhudiciaria, implementaçon de puestos de commisaría, monitorizaçon les 24 hores de los rîos, nun ha hi nada”. Mesma impression de parte d’Olivier Goudet, voceiru l movimento Trop Violans: “La question de l abertura de los territorios anda da fheitscho absente. Sperábemus medides concretes, nun les ascuîtschemus. In materia segurança, les respuestes nun son satisfactories.”

Refugu claru & nidiu

Al final, esta ye una negaçon clara & nidia oppuesta polos representantes del collectivu al plan rápidu presentau pol ministru l Interior, Matthias Fekl & pola ministra d’Ultramar Ericka Bareigts, validau por Matignon. Sábbado pela tarde na Guayana, polo de sou, los delegados les varies divisiones & sectores reaffirmaran toles revindicaçones (un quadernu de 428 revindicaçones in total), que delhes vezes abarca décades d’historia, bien detalhades & maniobrando cun múltiples coloratures.

Bien aina, tenemus visto stablicese un verdadeiru fhuexu d’incomprehension ente un movimiento que, si ser ye pacífico, siente-se portador d’una ambiçon histórica & de lantre un gubierno que tien los díes contaus, que reconoç la fhuerça l movimiento,  que pretende traher no possible respuestes concretes & precises pero nun podiendo dir aculhá de lo possible. Nun se son a recuperar in trés selmanes trenta anhos d’atrasu . & de que valríen compromissos que tienen dala possibilidá de ser cumplidos?

El diálogu que començou a disinvolvese ente l Ministru d’Ultramar (el ministru d’Interior hôubo torna’ l sábbado a Paris, dades les outres oblrigaçones a les que tien que s’enfrentar) & los representantes del movimiento ye, por tanto,  bien precariu. La Sra. Bareigts nun despera n aconceyar postures,  proponso-yos a los differentes pólos del collectivu (económicu, sanitariu, educacativu, energéticu, de segurança, territorial, de communidaes natives …) continuar debatiendo da concreto per stayes.

Reunion interministerial a primeiru selmana

El collectivu determinou dir ta lo mas fhundeiro possible, & de mano, ta l cabu la nueitsche. Ente tanto los delegados andaben expressando les suês revindicaçones al ministru, la xhente, u varies centenes de persones stan presentes na plaça de la prefeitura de magar pela manyana, continuou inxamando. Quando los sos representantes tomarun la pallabra n balcon de la prefeitura pa dar cuenta de los progressos de la situaçon, camin de les 20:30 hora local, de 2000 a 3000 manifestantes stuvierun presentes. El mesmu appelhidíu surdîu: “Nou pa bougé la, nou domi la” (“Nun martscharemus, dormiremus ende”). & vienen preparados pa elho.

La Sra. Bareigts de mano debe dir a Paris a una xunctura interministerial in Matignon el primeiru de la selmana intorno l primer ministru, Bernard Cazeneuve, a cerca la situaçon na Guayana & les decisiones que l gubierno se responsabiliza tomar deberan ser validades el miércoles in conseyo ministros. La nueitsche provicerá n Cayenne.

Fhonte:

http://www.lemonde.fr/politique/article/2017/04/01/en-guyane-les-annonces-du-gouvernement-peinent-a-convraincre_5104482_823448.html

In crisis, pero sanos, los italianos primeiros del mundo pola salude

El nuessu pays no cimeiro la lhista Bloomberg, que considera la duraçon & la qualidà de vida. Mas que la riqueza, cuenta la dieta mediterranea.

ROMA – Si lo mas importante ye la salude, Italia tien cumo pa vender. Magar les suês dècades de crecimiento econòmico que (d’habelo) para n punctu zero, magar un paru de los màximos d’Europa, magar una crònica instabilidà polìtica, la cartielha mèdica de los sùbditos tricolores confirma-se cumo la meyor del planeta. Quanto si mas 93,11 punctos sobre 100 segun l Indiç Global de salude divulgau pola Bloomberg, indicador que lheva cuenta d’una serie de factores talos cumo la expectativa de vida, nutriçon, salude mental & factores de riesgo cumo l fumar ou la tension arterial.

Primeiru, por tanto, de 163 paises que se consideren. Adiuda una expectativa de vida al nacer de los nenhos italianos que agora trespassa los 80 anhos (en comparança colos 52 de Sierra Leone, cabeira n esti paràmetro). Mas que la durada, cuenta tamien la qualidà. El nuessu paìs trespassa da fheitscho outres naçones conhocides pola suâ gran duraçon de vida: del norte Europa (Islanda ye segunda a 91.21 punctos, Suecia, a 88.92), n Oriente (Xhapon a 89.15, el ricu Singapur a 90.23), al nuessu primu l Mediterraneo (Hispanya ye sexta cun 89.19 punctos). Por cierto, la nuessa dieta, patrimonio cultural immaterial de la Unesco, ye l ingrediente principal d’esta salude de fhierro…

Por se’ la fholgura psycho-phýsica minor noutros paìses per-mas ricos que l nuessu como Allemania, puestu 16, ou nos USA, mesmamente l 34. Nun m’intender mal: la vinculaçon ente renta per càpita & salude ye nidia, esso se demuenstra da fheitscho por nun fhaer parte solo Chypre & Singapur de la OCDE de los cimeiros 20 del Indiç Bloomberg, les economíes mas puxantes del planeta. Magar la riqueza tornase salude solo combinada cun factores culturales, cumo l attençon pa cun la comida ou l vezu l actividà phýsica. D’outra maneira, tamien ye a tornase cholesterol nes arteries coronaries del sou amu: como nos USA, mostrando una taxa d’obesidà ente les mas altes del mundo cumo les principales causes de sou de la suâ ruina prestaçon nel scalafon. Sperando improbables puestes in martscha del PIB pa lantre, nós outros italianos vamus agarranos fhuertemente a la fruîta, a la pasta & al azeyte d’oliva.

Fhonte:

http://www.repubblica.it/economia/2017/03/20/news/italia_salute_prima_bloomberg-160975269/?rss

La nueva banda l venau Sven

Audio:

In Flensburg, un venau axhunctou-se a una cabanha de weis Galloway. “Elhi piensa agora mesmo que ye un wei”, diz un conservacionista.

Nun ye nidio da fheitscho, si Sven ye emigrante ou non. Ye nidio: Sven integrou-se bien na suâ nueva casa n Schleswig-Holstein. Agora vive cun una cabanha de weis Galloway de cerca 60 cabos. Lo extraordinario: Sven ye un venau.

“Nun sabemus del todo que ye lo que lu puxa”, diz Gerd Kämmer de l associaçon de protecçon de la naturaleza Bunde Wischen, a la que perteneç el fhatau. Sven nun fhoi cibau. Afhixzo la suâ vida quotidiana a la de la cabanha. Distinctu de la suâ propria specie, que ente tanto anden per-comiendo na mata, da vezo mesmo pela nueitsche pola pression de la xhente, Sven ye diurnu.

Los ciervos nun son ya autochthones del pays.

“Da primeires yera per-tìmidu, mal se lu podìa ver cun binòculos a grandes distancies. “Agora atyega-se-y un a venti metros de distancia”, diz Kämmer del venau, que ye residente regular ha cammin ya de dous anhos de la morteira de la Fundaçon Schäferhaus na raya germano-danesa.

Pensaba-se primeiro que Sven fhexziera solo un haltu na cabanha. Nos postreiros dous veranos, tuvo disappaecìu per selmanes pero arrretornou precisamente pa la tuxa. Kämmer suspeitschou de mano que Sven “venìa de la parte danesa a la gëta venades, visto que per essi tiempu siempre volvìa”.

Los ciervos nun son ya autochthones del Schleswig del Sur. Los ciervos al norte la fronteira, in non atopando pacion & cun poucu sitiu, van immigrando cada vegada mas pal Schleswig-Holstein. Nel districtu vizin de Nordfriesland, los caçadores ya protestáran ha pouco por xorrece’ los stropicios nes mates por causa los wèspides scandinavos. “El stongu nutritivu de los arboles nuevos ye tenìu por exquisitez polos animales & presta-yos spulgalu”, annunciou l administraçon del districtu acabante Noviembre.

Nes cien hectarees del antigu campu d’entreinamiento militar u los Galloways se tienen afheitscho, agradeç-se bien ver a Sven cul sou magnìficu cornamen. “Nòs nun queremus practica’ la conservaçon de la naturaleza solo cumo si stuviere cobierta so la campana crystal d’una queiseira, ma tamien que s’apprehenda de lo que fhaemus”, diz Kämmer.

Al conceitu perteneç tamien que l venau podia martschar in qualquier momento. Sven ye a blrincar per riba l cierre de quajsi un metro de la morteira de la cabanha. Cun la intençon de nun se y mangar in diana a qualquier caçador si yi diera por salir de la reserva natural, que tien abondos visitantes, quier el biòlogu Kämmer “amparalu cun la suâ fama”.

Tornará-se Sven bravu outra vez n un bàlamu ciervos monteses? nun se sabe. “Elhi bien que se tien agora por un wei,” dixo ha pouco Kämmer al Flensburger Tageblatt.

Fhonte:

http://www.sueddeutsche.de/panorama/suedschleswig-die-neue-gang-von-rothirsch-sven-1.3395564

Cumo salva’l Capitalismo de si

In Future of Socialism Anthony Crossland re-impobinou la ezquierda del Marxismo a la Social-Democracia. Scripto n 1956, abarruntou no que se tornaría la philosophía europea dominante. La Social-Democracia resolvîu cun gloria los grandes problemas de la dómina; pero problemas nuevos tienen de magar appaecido, polo que esta nun tien agora una narrativa de credibilidá, ou una soluçon creíble. La Social-Democracia anda agora n ruines, el sou fhatau de polítiques refutades pol eleitorau. El sou splendor fhoi l trente glorieuses, 1945 – 75, pero, cumo Marc Levinson relata n An Extraordinary Time, los spléndidos rendimientos d’aquelha nun son a attribuyise d’officio a sbilhes de bona política económica. In cuentes d’esso, cambios téchnicos fortuitos & coyunctures structurales a favor d’excepçon coincidierun elevando los patrones de vida occidentales. In circumstancies bien differentes de les de wey, retornando al keinesianismo & a la tributaçon redistributiva de la Social-Democracia de los anhos 1960 ye improbable restaura’l eden. El lhibru de Levinson, que trunya scontra la triste historia de la mala administraçon económica ta 1990, ye un antídotu valiosu contra toles doutrines económiques sofhitades cun passion. Levinson insenya-nos que l “afine” keynesianu de la demanda fhoi abandonau por una bona razon; sí que ansí la suâ substituçon por cortes d’impuestos pa ricos & l infoque no monetario nun salierun meyor. Pa aquelhos bien dispuestos, recommiendo combinar esti studio cun un trabayu brilhante de Paul Romer the Trouble with Macroeconomics (disponible gratuitamente na Rede), que abrasa los últimos 25 anhos de theoría macroeconómica. lheyendo estos dous xhunctos rescampla que dala theoría económica prestosa restaurará la bayura massiva.

Ente tanto, los únicos “ruptidos” contemporaneos de la ezquierda son marxismo de sparaban. Na década anterior a la derrota l communismo, hôubo una rabaseira lhibros preveyendo la derrota l capitalismo, & los recuerdos tenran-se evidentemente ya aflrouxaho abondo cumo pa sofhitar un renacimiento. L avangarda dogmática atopará How Will Capitalism End? de Wolfgang Streeck inflau & pretenciosu a sgaya, ente tanto a los fatos útiles incamiento Four Futures: Life after Capitalism de Peter Frase, tan prestosamente inspirador. Si valoraes estos lhibros, será a presta-vos tamien, por dizir daqué, Harry Potter. Sí que ansí, ente que l capitalismo al cabu cinca electoralmente victorioso & philosophicamente n sin rival seriu, el sou resultau tornou-se manifiestamente insatisfactoriu. El sou nucleu referencial de meyora constante l patron de vida universal nublrou-se enforma: la mayoría spera agora que los fhiyos tengan una vida mas ruina que la propria. Ye hora de “the Future of Capitalism”. Infelizmente, indagora nun se scribîu cun éxitu tal lhibru. Cumo elhi falta, vou tentar de teixer daqué partiendo de los fhilos de les recientes contribuçones n esti campu.

Lo que surde nun será una nueva doutrina. Si Levinson nun vos ye a convencer, probai The Fix de Jonathan Tepperman. El títulu refier-se non al nuessu ingëdeyu actual, ma a diez studios d’exemplos de cumo delhos caudielhos políticos transformáran na realidá situaçones pa meyor. Tepperman gëta la fórmula cun la que estos remediáran problemas graves. Los casos son valiosos por si mesmos: abondos mandatarios podríen deprehender cumo Lee Kwan Yew expulsou la corrupçon de Singapur, cumo Pierre Trudeau disarmou l separatismo quebecois, & de cumo Paul Kagame arrefhixzo identidaes culturales in Rwanda. Si que ansì pa los fines presentes ye la conclusion de Tepperman la que val: evitai l dogma; apunctai soluçones pragmátiques pa los problemas centrales, afhazéi-vos conforme avancedes, pero ponéi-vos tan firmes cumo fhuere necessario. Un futuro viable pal capitalismo trespassará tola doutrinaria l sieglo XX: scaeicéi ezquierda contra dreitscha, deixai a parte la zuna de la moralizaçon presumptuosa & intamai cun los problemas. Cumo Tepperman argumenta, los mandatarios que apanyarun cun rigor esta postura infrentarun-se d’intamu cun fhuertes crítiques. El pragmatismo garante offender a ideólogos de toda mena & que son los que dominen los medios. Una identidá situando-se “a la ezquierda” tien sido una maneira ruina de sentise moralmente superior; una identidá situando-se “a la dreitscha” tien sido una fhorma ruina de sentise intelectualmente superior. Bien venidos al pragmatismo: el centro duro.

Los nuevos problemas que l pragmatismo tien falta iguar manifiesten-se cun la nueva roxura contra les elites. La base social de la roxura ye territorial, educacional & moral. Son les comarques que se rebelen contra les mega-agglomeraçones: norte d’Anglaterra contra Londres & el Sur, el Centro contra les Costes. Son los que menos formaçon tienen rebelando-se contra los que mas educaçon tienen. Ye la lhuîtscha de los “vou-tirando” rebelando-se contra los irresponsables. Los ignorantes, coveyos de provincia, substituyen a la classe trabayadora cumo fhuerça revolucionaria na xhente: nun son tanto los sans culotte cumo los sans cool. Intós, contra que ye lo que anda esta xhente? Les fortunes de la nueva elite spoyetarun, da quando sin merecelo enforma, ente tanto aquelhes de los sans cool deteriorarun-se. La rabia tinye-se de lherça: pa los sans cool anden-yos baltiando la seguridá económica. Pero la rabia & el mieu trespassen lo económico: la xhente ve a los miembros de la elite educada Sur/Costa relaçonando-se ente elhos mesmos (“relacionamiento selectivo”) & abraçando una identidá globalizada, affirmando la suâ superioridá moral, animando les suês capes prioritaries favorecides cul aciu de resaltar characterístiques tales cumo ethnia & orientaçon sexual cumo identidaes de “Communidá” exclusives. Los sans cool intienden que tanto l divorcio de la elite cumo l nacimiento de los nuevos collectivos favorecidos, apparentemente atropando adiudes, aflrouxa la suâ revindicaçon de prebendes, al in par la suâ necessidá de sofhitu spoxiga. Effectiva – & pragmaticamente – estes trés preoccupaçones de los sans cool son el retu incarau polos nuessos mandatarios.

Primeiro, crecimento cun xhusticia. Intamo cun essi campu griesca tradiçonal ente ezquierda & dreitscha, tributaçon. La griesca convencional consistiera n quan fhuerte han tributar aquelhos cun rendimientos altos. La fiscalidá ye importante, pero ye la qüestion falsa.

In futuro, la tributaçon debrá fhaer distincçones cun base menos in cumo se tien fheitscho denheiro abondo, & mas en cumo fhoi fheitscho. Ruchir Sharma destaca-lo n The Rise and Fall of Nations cun simplemente mira’ les lhistes billionarios & comparando, pais por pais, quantes persones fhexzierun les suês fortunes de la innovaçon cun aquelhes que les fhexzieran de la capta rentes. In naçones bien exitoses lo primeiro predomina; nes sociedaes mal gubernades son los buscones de rentes los que xorrecen. Pero la complexidá creciente de les nuesses economíes aportou nueves possibilidaes de rentes. Delhos mercaus ven-se imburriaus aculhá l sou Poder effectivu pa assignar recursos in sin regulaçon nueva, recalque habil fheitschu por Raghuram Rajan & Luigi Zingales en Saving Capitalism from the Capitalists. In respuesta a la complexidá, les taxes han tornase de contextu specíficu n cuentes de rendimiento specífico. La nueva maniobra será taxar les bolses de rentes.

Fhonte:

http://www.the-tls.co.uk/articles/public/how-to-save-capitali

El fraude l Amor arromantizau

Audio:

La fhorma cumo l Amor ye mayormente representau n telenoveles, cine, cantares ou lhibros dá que pensar, naciendo quajsi que siempre cumo inevitabilidá, daqué absoluto, una essencia & nunca una construcçon.

Calma. L Amor-propriu, l Amor polos outros, l Amor polo que ye humano, l Amor pol planeta, l Amor cumo supperaçon del disincantu, l Amor universal, l Amor cumo fhorma de lhidiar cun la muerte, l Amor urdíu cun constancia a dos ou tamien l Amor cumo arrogancia política son primordiales. L embuste ye l Amor arromantizau.

Ha unes selmanes vía un episodio d’una telenovela & mira per onde que dos protagonistas tschocaben in caleyando & quedaben prendaus. Ha dous díes miraba outra & atopei-me cul mesmu typu de ritual. Conclusion: Si vos appeteç prendavos, lo que se tien de fhaer ye dir caleyar & tschocar cun disconhocidos.

Quando la tyamada “chímica” se stableç todo ye possible, paeç querer communicanos. Ye daqué extranya esta fhorma de contanos-lo. Cumo aconteç cul Nataliegu. Nun tenemus fe da veres in Sancta Klaus, pero comportámunos todos de fhorma tala cumo fhaziendo que sí. Polo menos ansí lo continuamus reproduciendo anhu tres anhu. In casu l Amor ye ermano.

La fhorma cumo esti ye mayormente representau n telenoveles, cine, cantares ou lhibros dá que pensar, naciendo quajsi que siempre cumo inevitabilidá, daqué absoluto, una essencia & nunca edificaçon. Nun surprehende exsistir tantes persones per ende decepcionando-se ou culpabilizando-se, viendo les suês expectatives constantemente defraudades & quien lo agradeç ye la creciente industria d’autoadiuda.

De magar practicamente nacemus, fhaen-mos acceitar una riestra d’idealizaçones. Por casu? Ye normal conhocer daquien & d’immediato sentir una attracçon special. Debemus gïyanos solo polos sentimentos en sin consideraçones práctiques. Ye possible intendenos intuitivamente sin fhalar enforma. Sexu satisfactoriu ye synónymu d’una bona relaçon. Nunca mas debemus sentinos prendaus por outra xhente. Ou una relaçon duradeira ha  contener al passa’ los anhos los attributos excitantes que s’associen a la transitoriedá de la passion.

Cumo ye evidente, estes son idees prestoses. & ye bien possible que abondes relaçones se consigan elevar a partir d’estos presuppuestos. Pero son una minoría. La realidá relacional de l amplia mayoría ye per-differente, abondo mas engëdeyada & nun se compadeç d’esti typu de conceiçones, que n gran medida son elaboraçones sociales ou culturales que, por mas que nos cuesten d’acceitar, acaben por influencia’ les nuesses decisiones mas íntimes.

La historia insenya-nos exsistir abondes approximaçones al Amor, differentes percepçones de cumo los amantes tienen que se relacionar & diverses fhormes d’interpretar que ye aquelho que sentimus quando sentimus. Fhai falta intos iguar outru gïon pal Amor, sustituyendo esti patron por una vision mas madura. Daqué que nos lheve a assumir que no siempre atopamus todo na outra persona & viceversa. que discutir qüestiones práctiques nun ye traiciona’ la relaçon. Que nós nos atopamus nel outro pol repartu de les potencialidaes, pero tamien, & quanto si mas essencialmente, nes debilidaes. Que tenremus de poner infhoutu comprehendiendo-nos mutuamente & por elho fhai-nos falta saber verbaliza’ les emoçones.

De la mesma fhorma fhai fhalta tener presente que ye normal que les persones se seduzan & que la única forma d’evitar adulterios ye precisamente tener consciencia d’esso por sabelo tractar meyor. Ou que toles connexiones passen per fluctuaçones. Ou que ya nun vivimus na dómina n que les relaçones yeren determinades poles families, cun todo, les connexiones que ansí stablicemus son condiçonades polos collectivos sociales. Agora paecen ser mesmamente los algorithmos los que definen cun quien nos debemus atopar.

Les relaçones series requieren perseverar, noçon d’adelantrar & de retroceder, arreparar en que momentos d’harmonía cohabiten cun infrentamiento, de la mesma fhorma que exsisten phases d’effervescencia pero tamien de calma, tantes vezes tracamundiada por monotonía. Por paradoxal que podia paecer, talvez se tenga falta abraça’l Amor cumo una xheira & non cumo un acontecimento que se ha salvar, assumiendo que debemus apprehender a arrepensanos los affectos.

&, cun todo, esso nun ye garantía de nada.

Fhonte:

https://www.publico.pt/2017/02/14/culturaipsilon/noticia/a-fraude-do-amor-romantico-1761966

Superattracçon Islandia, in manos d’investores privaus?

Les revolades a Islandia anden ha ya unos quantos anhos a l alza. Abondes attracçones: El lhagu azul, dezenes de fherviences, panoramas de deixar in sin aliendu & phenòmenos naturales ùnicos. Una de les principales attracçones la isla, el lhagu glaciar Jökulsárlón, ye agora thema d’una griesca legal.

Jökulsárlón, ye l mayor lhagu glaciar d’Islandia & una de les attracçones tourìstiques mas importantes del pais. Cada dìe, arremielhen milhares de touristas los icebergs, pairantes na awa l lhagu. Pente una passeira strẽitscha, los icebergs impobinen-se pal mar, u los catschones del Oceano Atlàntico los açouten directamente al sableiru.

El lhagu tamien fhoi decorau d’una scena de persecuçon spetacular nel film de James Bond, “Die Another Day”. Pa tras, el lhagu tamien sobresal in bien d’outros films cumo “Lara Croft: Tomb Raider” & “Batman begins”.

El lhagu yera solo propriedà parcial del gubierno islandes. L outra parte andaba acommunyada por 40 proprietarios. Nun se ponxierun a communya cun la explotaçon del sitiu tourìsticu & decidierun intos vende’ la parte de sou.

In noviembre l anhu passau un fundu d’investimiento tyigou a poner in riba la mesa mediu milhardu de corones islandeses (12,3 milhones d’euros) pa gran fastidio de collectivos ambientalistas que preferìen que Jökulsárlón remaneciere nes manos del gubierno.

El gubierno islandes fhixzo usu intos del sou dreitschu de preferencia sobre l lhagu & igualou l envite de los investidores, pero a communya cun la impresa financeira, a la offerta l gubierno vagaran-y dous díes lhouew de caduca’l plrazo legal. El tribunal ha decidir agora quien ye l amu l lhagu.

Ente tanto los financiadores privaus quieren dir a lantre disinvolviendo l sitiu & queriendo-y fornecer todu typu d’equipamientos tourísticos, al gubierno prestaba-y incluyilu n parque nacional Vatnajokull & poner mas èmphasis sobre la protecçon del lhagu glaciar.

Fhonte:

http://www.standaard.be/cnt/dmf20170210_02723214?utm_source=twitter&utm_medium=dlvr&utm_campaign=twitterfeed

Acabar cun requisitos de patentes & dreitschos auctorales del NAFTA

Los accuerdos commerciales que s’anden negociando nel últimu quartu sieglo centren-se menos nes barreires commerciales tradicionales, que nes tarifes & nes quotes. In cuentes d’esso, anden imponiendo una structura de regulaçon de les partes, que tienden a per-orientase a los negocios. In casos abondo, les rieglres requerides polos accuerdos commerciales nunca s’acceitaríen si passaren pel processu políticu normal.

La renegociaçon l accuerdu lhibre commercio d’América l Norte deixa que los USA, Canadá & México se lhibren de rieglres que nun tienen sitiu n accuerdos commerciales. No cimeiro d’esta retafhila anden los tribunales de Resoluçon de Controversies d’Investidores-Stau (ISDS). Estos tribunales operen a fhuera l processu xhudicial normal. Les suês decisiones nin son vinculades por precedentes, nin son submittides a recursu. Pa de tras, estos mal s’abren a penes a los investidores d’a fhuera cumo mechanismu pa xhulgar a los gubiernos miembros.

Estos tribunales son a utilizase penalizando a gubiernos por medides destinades a defende’l ambiente, a los consumidores, a los trabayadores ou a assegura’ la stabilidá de les instituçones financieires. La TransCanada, la impresa que andaba iguando l gasoductu XL, dîou-nos una prueba de cumo essos tribunales podíen usase. Iniciou-se un processu lhouew de decidi’l presidente Barack Obama cancela’l oleoductu. Ye probable que veamus mas xhulgamientos in futuro usando los tribunales si se permitte nel NAFTA & noutros accuerdos commerciales.

Estes son fhormes de proteccionismo que son a alça’l precio de los bienes que ampara, lo que ye specialmente pernicioso n casu los medicamentos.

Los outros elementos no commerciales que deben eliminase del NAFTA son les disposiçones que requieren una fhuerte protecçon de les patentes & de los dreitschos d’auctor. Estes son fhormes de proteccionismo – l’oppuesto al commercio lhibre – que son a eleva’l precio de los bienes amparaus por un factor 10 ou mesmamente de 100. El guelpe d’esses protecçones ye specialmente perniciosu in casu de medicamentos.

Drogës que seríen immediatamente disponibles nun mercau lhibre podríen ser prohibitivamente cares pola protecçon de patentes. Por casu: el medicamentu de la Hepatitis C Sovaldi tien un precio d’US $ 84.000 nos USA. Una version expatentada d’alta qualidá vende-se na India por menos d’US $ 200.

Magar les impreses necessitar d’un incentivu pa innovar, exsisten mechanismos abondo mas efficientes que los monopolios de patentes. Nun tien xacíu dependese n una economía l sieglo XXI d’esta reliquia l systema gremios feudales cul fin de sofhita’ la innovaçon.

Acabar cun los requisitos de patentes & dreitschos auctorales nel NAFTA diba ser un bon primer passu. Fhai-nos falta una mesa redonda mas profunda sobre la modernizaçon de los nuessos systemas de financiaçon de la innovaçon & del trabayu creativu.

Fhonte: